Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122298599:

Variant ID: vg1122298599 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22298599
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATGCAGGTTAGCTGGAGTAGTAGACAACGTATGTACAGTTGACAGGGAGAGGCTCATGATAACGTTAATTTTAAGACATACCGACCAAATGTATTAGA[C/G]
GTTCTGATAGATGTGGAGTGAGTATATATACAATTTAAGTGTCTATATTTAAAATGTGTTTTAAAAACAAATACTCCTTCACTTACGTTCCTTCACTATT

Reverse complement sequence

AATAGTGAAGGAACGTAAGTGAAGGAGTATTTGTTTTTAAAACACATTTTAAATATAGACACTTAAATTGTATATATACTCACTCCACATCTATCAGAAC[G/C]
TCTAATACATTTGGTCGGTATGTCTTAAAATTAACGTTATCATGAGCCTCTCCCTGTCAACTGTACATACGTTGTCTACTACTCCAGCTAACCTGCATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	7.80%	0.34%	0.11%	NA
All Indica	2759	98.90%	0.70%	0.22%	0.18%	NA
All Japonica	1512	77.10%	22.40%	0.53%	0.00%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	97.30%	1.70%	0.38%	0.64%	NA
Temperate Japonica	767	92.20%	7.30%	0.52%	0.00%	NA
Tropical Japonica	504	64.50%	35.30%	0.20%	0.00%	NA
Japonica Intermediate	241	55.60%	43.20%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122298599	C -> DEL	N	N	silent_mutation	Average:62.09; most accessible tissue: Zhenshan97 root, score: 95.586	N	N	N	N
vg1122298599	C -> G	LOC_Os11g37720.1	upstream_gene_variant ; 3311.0bp to feature; MODIFIER	silent_mutation	Average:62.09; most accessible tissue: Zhenshan97 root, score: 95.586	N	N	N	N
vg1122298599	C -> G	LOC_Os11g37710.1	downstream_gene_variant ; 3806.0bp to feature; MODIFIER	silent_mutation	Average:62.09; most accessible tissue: Zhenshan97 root, score: 95.586	N	N	N	N
vg1122298599	C -> G	LOC_Os11g37710-LOC_Os11g37720	intergenic_region ; MODIFIER	silent_mutation	Average:62.09; most accessible tissue: Zhenshan97 root, score: 95.586	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1122298599	C	G	0.01	0.0	0.0	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122298599	4.89E-06	3.95E-07	mr1126_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122298599	NA	7.77E-06	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122298599	NA	7.43E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122298599	NA	9.77E-09	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122298599	NA	1.08E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122298599	NA	1.47E-07	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122298599	2.09E-06	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251