\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122240342:

Variant ID: vg1122240342 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22240342
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATGTCCGTTACTATTGAAGAGTTATATAGCACGAAAAAATTCATTAGCTTGTGATTATTTGAATTTTAGTTGTTATAAACTTAAAAAATAGATTTTT[C/T]
TAATATTTGGAACAACTTCCATATACATTTTTTTTATAAAATGCTACTTTGTCCAAAAAAGACAAAACTCTAGCTACAAATTTAAACACACATGTATTCA

Reverse complement sequence

TGAATACATGTGTGTTTAAATTTGTAGCTAGAGTTTTGTCTTTTTTGGACAAAGTAGCATTTTATAAAAAAAATGTATATGGAAGTTGTTCCAAATATTA[G/A]
AAAAATCTATTTTTTAAGTTTATAACAACTAAAATTCAAATAATCACAAGCTAATGAATTTTTTCGTGCTATATAACTCTTCAATAGTAACGGACATCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.40% 0.00% 0.00% NA
All Indica  2759 84.70% 15.30% 0.00% 0.00% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 33.10% 66.90% 0.00% 0.00% NA
Indica I  595 89.90% 10.10% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 74.90% 25.10% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.80% 0.00% 0.00% NA
Temperate Japonica  767 94.40% 5.60% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122240342 C -> T LOC_Os11g37670.1 downstream_gene_variant ; 1058.0bp to feature; MODIFIER silent_mutation Average:59.153; most accessible tissue: Minghui63 flower, score: 89.903 N N N N
vg1122240342 C -> T LOC_Os11g37660-LOC_Os11g37670 intergenic_region ; MODIFIER silent_mutation Average:59.153; most accessible tissue: Minghui63 flower, score: 89.903 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122240342 C T 0.0 0.01 0.01 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122240342 NA 7.74E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122240342 2.91E-06 2.36E-07 mr1800 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122240342 NA 9.79E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251