\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122231601:

Variant ID: vg1122231601 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22231601
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGGCTCGATGTTTGAGCTTTCCGATAGGCTCGGCTCGAGCTCGATCAAGCTCAAACTCGACTACCGAGCTTGATTTTAAAGTAAAACAATATATATTT[C/T]
AAAGATAATCTTTTAAAAAATAATTAACTTCTAGTTCATCATATTAATAGATGAGGAGAAAAGAATAAAATAAATATATGATGTCAATATAAGACATACA

Reverse complement sequence

TGTATGTCTTATATTGACATCATATATTTATTTTATTCTTTTCTCCTCATCTATTAATATGATGAACTAGAAGTTAATTATTTTTTAAAAGATTATCTTT[G/A]
AAATATATATTGTTTTACTTTAAAATCAAGCTCGGTAGTCGAGTTTGAGCTTGATCGAGCTCGAGCCGAGCCTATCGGAAAGCTCAAACATCGAGCCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 11.90% 6.98% 11.34% NA
All Indica  2759 64.40% 13.50% 10.51% 11.60% NA
All Japonica  1512 82.50% 12.10% 0.93% 4.43% NA
Aus  269 73.20% 0.00% 4.09% 22.68% NA
Indica I  595 65.90% 18.80% 13.95% 1.34% NA
Indica II  465 49.50% 27.10% 15.91% 7.53% NA
Indica III  913 70.40% 2.10% 6.57% 20.92% NA
Indica Intermediate  786 65.10% 14.60% 9.29% 10.94% NA
Temperate Japonica  767 88.10% 9.10% 1.30% 1.43% NA
Tropical Japonica  504 82.50% 11.30% 0.20% 5.95% NA
Japonica Intermediate  241 64.70% 23.20% 1.24% 10.79% NA
VI/Aromatic  96 18.80% 0.00% 9.38% 71.88% NA
Intermediate  90 65.60% 6.70% 6.67% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122231601 C -> T LOC_Os11g37660.1 upstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:61.835; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N
vg1122231601 C -> T LOC_Os11g37660-LOC_Os11g37670 intergenic_region ; MODIFIER silent_mutation Average:61.835; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N
vg1122231601 C -> DEL N N silent_mutation Average:61.835; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122231601 C T 0.02 0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122231601 NA 7.74E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 9.12E-08 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 8.66E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 2.52E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 9.33E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 4.98E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 7.24E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 NA 2.83E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122231601 1.15E-06 1.14E-06 mr1983_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251