\
| Variant ID: vg1122225663 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22225663 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 209. )
TATAACGTCGATGACTTTTTAGATATATATGATCATTCGTCTTATTCAAAAAAAAATGCAATTATCATTTATTTTATTGTGACTTAATTTATCATCAAAT[G/A]
TTCTTTAAGCATGACTTAAATTTTTTTTATATTTGCACAATAATTTTGAATAAGATGAATGGTCAAATGTTTGTCAAAAAGTCAACAACGTCATACATTA
TAATGTATGACGTTGTTGACTTTTTGACAAACATTTGACCATTCATCTTATTCAAAATTATTGTGCAAATATAAAAAAAATTTAAGTCATGCTTAAAGAA[C/T]
ATTTGATGATAAATTAAGTCACAATAAAATAAATGATAATTGCATTTTTTTTTGAATAAGACGAATGATCATATATATCTAAAAAGTCATCGACGTTATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 14.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 84.60% | 15.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 93.60% | 6.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.30% | 30.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 84.20% | 15.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.20% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122225663 | G -> A | LOC_Os11g37660.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.447; most accessible tissue: Minghui63 root, score: 59.984 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122225663 | NA | 1.56E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122225663 | NA | 6.53E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122225663 | 2.90E-06 | NA | mr1945 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122225663 | NA | 9.89E-06 | mr1350_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122225663 | NA | 5.68E-09 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122225663 | NA | 4.07E-06 | mr1855_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |