\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122225663:

Variant ID: vg1122225663 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22225663
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TATAACGTCGATGACTTTTTAGATATATATGATCATTCGTCTTATTCAAAAAAAAATGCAATTATCATTTATTTTATTGTGACTTAATTTATCATCAAAT[G/A]
TTCTTTAAGCATGACTTAAATTTTTTTTATATTTGCACAATAATTTTGAATAAGATGAATGGTCAAATGTTTGTCAAAAAGTCAACAACGTCATACATTA

Reverse complement sequence

TAATGTATGACGTTGTTGACTTTTTGACAAACATTTGACCATTCATCTTATTCAAAATTATTGTGCAAATATAAAAAAAATTTAAGTCATGCTTAAAGAA[C/T]
ATTTGATGATAAATTAAGTCACAATAAAATAAATGATAATTGCATTTTTTTTTGAATAAGACGAATGATCATATATATCTAAAAAGTCATCGACGTTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 14.60% 0.13% 0.00% NA
All Indica  2759 84.60% 15.30% 0.11% 0.00% NA
All Japonica  1512 93.60% 6.20% 0.20% 0.00% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 69.30% 30.60% 0.11% 0.00% NA
Indica Intermediate  786 84.20% 15.50% 0.25% 0.00% NA
Temperate Japonica  767 97.40% 2.20% 0.39% 0.00% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122225663 G -> A LOC_Os11g37660.1 intron_variant ; MODIFIER silent_mutation Average:40.447; most accessible tissue: Minghui63 root, score: 59.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122225663 NA 1.56E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122225663 NA 6.53E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122225663 2.90E-06 NA mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122225663 NA 9.89E-06 mr1350_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122225663 NA 5.68E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122225663 NA 4.07E-06 mr1855_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251