\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122197777:

Variant ID: vg1122197777 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22197777
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


TGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCCGCAGTCCCTACCCACACAAATGTACAAGTTCCATCATCTGTACATGGAGATGAGCGCCAT[T/C]
GGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGC

Reverse complement sequence

GCTGGTATAGTTCGTAGATTCCCTTGAAATTGATCCAGAGAATGTCATCTCCTTGCAAGAAGTCCGTGTCCCTGATCCTCGCTCCGATCATCTCTCTACC[A/G]
ATGGCGCTCATCTCCATGTACAGATGATGGAACTTGTACATTTGTGTGGGTAGGGACTGCGGCAGCTCAGGCTTGACAAGCGGTTTACCGAGTTCGTACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.30% 5.30% 33.39% 38.98% NA
All Indica  2759 9.60% 1.50% 36.28% 52.66% NA
All Japonica  1512 37.10% 12.80% 29.96% 20.17% NA
Aus  269 61.70% 3.70% 26.02% 8.55% NA
Indica I  595 11.30% 0.30% 38.49% 49.92% NA
Indica II  465 3.40% 0.60% 21.94% 73.98% NA
Indica III  913 11.30% 2.40% 45.67% 40.64% NA
Indica Intermediate  786 9.90% 1.80% 32.19% 56.11% NA
Temperate Japonica  767 62.70% 9.10% 10.30% 17.86% NA
Tropical Japonica  504 8.10% 12.50% 57.54% 21.83% NA
Japonica Intermediate  241 16.20% 24.90% 34.85% 24.07% NA
VI/Aromatic  96 43.80% 0.00% 30.21% 26.04% NA
Intermediate  90 25.60% 6.70% 27.78% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122197777 T -> DEL LOC_Os11g37600.1 N frameshift_variant Average:10.487; most accessible tissue: Callus, score: 21.895 N N N N
vg1122197777 T -> C LOC_Os11g37600.1 synonymous_variant ; p.Ile718Ile; LOW synonymous_codon Average:10.487; most accessible tissue: Callus, score: 21.895 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122197777 NA 1.06E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 6.21E-07 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 1.00E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 3.13E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 3.71E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 8.70E-07 8.69E-07 mr1796 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 2.43E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 3.51E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 3.41E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 1.25E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 2.14E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122197777 NA 2.41E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251