\
| Variant ID: vg1122184371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22184371 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATAATTTGGTGTAGTAAATATTGATATATTTTTCCTCAACAGTGGAAGTAGTTAATTTCTCTTAACATGCATATAGGGGCTATTTACTTATACTTGATC[A/T]
TAATTAGATGCACTTTTATAAATAAATGATCTTTTTAGAGATAAATAAACGTTCCTAATATGATCATAATATCTAAATTATACATATGATATCTGATGTC
GACATCAGATATCATATGTATAATTTAGATATTATGATCATATTAGGAACGTTTATTTATCTCTAAAAAGATCATTTATTTATAAAAGTGCATCTAATTA[T/A]
GATCAAGTATAAGTAAATAGCCCCTATATGCATGTTAAGAGAAATTAACTACTTCCACTGTTGAGGAAAAATATATCAATATTTACTACACCAAATTATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.20% | 3.70% | 7.13% | 2.94% | NA |
| All Indica | 2759 | 80.10% | 6.10% | 11.09% | 2.72% | NA |
| All Japonica | 1512 | 96.20% | 0.10% | 1.06% | 2.58% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.50% | 10.80% | 20.34% | 3.36% | NA |
| Indica II | 465 | 83.70% | 2.80% | 9.46% | 4.09% | NA |
| Indica III | 913 | 86.60% | 4.70% | 7.56% | 1.10% | NA |
| Indica Intermediate | 786 | 81.30% | 6.20% | 9.16% | 3.31% | NA |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.52% | 2.22% | NA |
| Tropical Japonica | 504 | 96.40% | 0.00% | 1.79% | 1.79% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.40% | 1.24% | 5.39% | NA |
| VI/Aromatic | 96 | 76.00% | 0.00% | 5.21% | 18.75% | NA |
| Intermediate | 90 | 80.00% | 1.10% | 11.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122184371 | A -> T | LOC_Os11g37570.1 | upstream_gene_variant ; 2815.0bp to feature; MODIFIER | silent_mutation | Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1122184371 | A -> T | LOC_Os11g37580.1 | downstream_gene_variant ; 2093.0bp to feature; MODIFIER | silent_mutation | Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1122184371 | A -> T | LOC_Os11g37570-LOC_Os11g37580 | intergenic_region ; MODIFIER | silent_mutation | Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1122184371 | A -> DEL | N | N | silent_mutation | Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122184371 | NA | 1.11E-08 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122184371 | 3.22E-06 | 1.61E-06 | mr1990 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |