Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122184371:

Variant ID: vg1122184371 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22184371
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAATTTGGTGTAGTAAATATTGATATATTTTTCCTCAACAGTGGAAGTAGTTAATTTCTCTTAACATGCATATAGGGGCTATTTACTTATACTTGATC[A/T]
TAATTAGATGCACTTTTATAAATAAATGATCTTTTTAGAGATAAATAAACGTTCCTAATATGATCATAATATCTAAATTATACATATGATATCTGATGTC

Reverse complement sequence

GACATCAGATATCATATGTATAATTTAGATATTATGATCATATTAGGAACGTTTATTTATCTCTAAAAAGATCATTTATTTATAAAAGTGCATCTAATTA[T/A]
GATCAAGTATAAGTAAATAGCCCCTATATGCATGTTAAGAGAAATTAACTACTTCCACTGTTGAGGAAAAATATATCAATATTTACTACACCAAATTATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.20%	3.70%	7.13%	2.94%	NA
All Indica	2759	80.10%	6.10%	11.09%	2.72%	NA
All Japonica	1512	96.20%	0.10%	1.06%	2.58%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	65.50%	10.80%	20.34%	3.36%	NA
Indica II	465	83.70%	2.80%	9.46%	4.09%	NA
Indica III	913	86.60%	4.70%	7.56%	1.10%	NA
Indica Intermediate	786	81.30%	6.20%	9.16%	3.31%	NA
Temperate Japonica	767	97.10%	0.10%	0.52%	2.22%	NA
Tropical Japonica	504	96.40%	0.00%	1.79%	1.79%	NA
Japonica Intermediate	241	92.90%	0.40%	1.24%	5.39%	NA
VI/Aromatic	96	76.00%	0.00%	5.21%	18.75%	NA
Intermediate	90	80.00%	1.10%	11.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122184371	A -> T	LOC_Os11g37570.1	upstream_gene_variant ; 2815.0bp to feature; MODIFIER	silent_mutation	Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1122184371	A -> T	LOC_Os11g37580.1	downstream_gene_variant ; 2093.0bp to feature; MODIFIER	silent_mutation	Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1122184371	A -> T	LOC_Os11g37570-LOC_Os11g37580	intergenic_region ; MODIFIER	silent_mutation	Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg1122184371	A -> DEL	N	N	silent_mutation	Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122184371	NA	1.11E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122184371	3.22E-06	1.61E-06	mr1990	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251