\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122184371:

Variant ID: vg1122184371 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22184371
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAATTTGGTGTAGTAAATATTGATATATTTTTCCTCAACAGTGGAAGTAGTTAATTTCTCTTAACATGCATATAGGGGCTATTTACTTATACTTGATC[A/T]
TAATTAGATGCACTTTTATAAATAAATGATCTTTTTAGAGATAAATAAACGTTCCTAATATGATCATAATATCTAAATTATACATATGATATCTGATGTC

Reverse complement sequence

GACATCAGATATCATATGTATAATTTAGATATTATGATCATATTAGGAACGTTTATTTATCTCTAAAAAGATCATTTATTTATAAAAGTGCATCTAATTA[T/A]
GATCAAGTATAAGTAAATAGCCCCTATATGCATGTTAAGAGAAATTAACTACTTCCACTGTTGAGGAAAAATATATCAATATTTACTACACCAAATTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 3.70% 7.13% 2.94% NA
All Indica  2759 80.10% 6.10% 11.09% 2.72% NA
All Japonica  1512 96.20% 0.10% 1.06% 2.58% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 65.50% 10.80% 20.34% 3.36% NA
Indica II  465 83.70% 2.80% 9.46% 4.09% NA
Indica III  913 86.60% 4.70% 7.56% 1.10% NA
Indica Intermediate  786 81.30% 6.20% 9.16% 3.31% NA
Temperate Japonica  767 97.10% 0.10% 0.52% 2.22% NA
Tropical Japonica  504 96.40% 0.00% 1.79% 1.79% NA
Japonica Intermediate  241 92.90% 0.40% 1.24% 5.39% NA
VI/Aromatic  96 76.00% 0.00% 5.21% 18.75% NA
Intermediate  90 80.00% 1.10% 11.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122184371 A -> T LOC_Os11g37570.1 upstream_gene_variant ; 2815.0bp to feature; MODIFIER silent_mutation Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1122184371 A -> T LOC_Os11g37580.1 downstream_gene_variant ; 2093.0bp to feature; MODIFIER silent_mutation Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1122184371 A -> T LOC_Os11g37570-LOC_Os11g37580 intergenic_region ; MODIFIER silent_mutation Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg1122184371 A -> DEL N N silent_mutation Average:10.114; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122184371 NA 1.11E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122184371 3.22E-06 1.61E-06 mr1990 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251