Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1122183779:

Variant ID: vg1122183779 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22183779
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATTCCTCTCTCCCTACCATTCCTTCTCTGTTCTTTCTTTACCTCCATAGAAACTAAATCCAACATTATCTTTGTGATAAAAAAAACTCCCACAAATGGA[T/C]
TCCGCCTAACAAGTCTAACCAGTTTCCCCTGTGTCATGTGCTTTTCTTCTCTTTCTCCTCAAGCTAGCACTTATAGAAACAACGTAAACTAGACTTTAAA

Reverse complement sequence

TTTAAAGTCTAGTTTACGTTGTTTCTATAAGTGCTAGCTTGAGGAGAAAGAGAAGAAAAGCACATGACACAGGGGAAACTGGTTAGACTTGTTAGGCGGA[A/G]
TCCATTTGTGGGAGTTTTTTTTATCACAAAGATAATGTTGGATTTAGTTTCTATGGAGGTAAAGAAAGAACAGAGAAGGAATGGTAGGGAGAGAGGAATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	0.30%	25.01%	23.59%	NA
All Indica	2759	28.30%	0.50%	35.45%	35.74%	NA
All Japonica	1512	92.80%	0.10%	2.51%	4.63%	NA
Aus	269	61.70%	0.00%	37.92%	0.37%	NA
Indica I	595	37.30%	1.00%	30.42%	31.26%	NA
Indica II	465	4.10%	0.60%	40.00%	55.27%	NA
Indica III	913	35.90%	0.20%	35.27%	28.59%	NA
Indica Intermediate	786	27.00%	0.40%	36.77%	35.88%	NA
Temperate Japonica	767	94.50%	0.10%	1.69%	3.65%	NA
Tropical Japonica	504	93.10%	0.00%	2.58%	4.37%	NA
Japonica Intermediate	241	86.70%	0.00%	4.98%	8.30%	NA
VI/Aromatic	96	17.70%	0.00%	48.96%	33.33%	NA
Intermediate	90	51.10%	1.10%	18.89%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122183779	T -> DEL	N	N	silent_mutation	Average:19.345; most accessible tissue: Callus, score: 35.147	N	N	N	N
vg1122183779	T -> C	LOC_Os11g37560.1	upstream_gene_variant ; 4896.0bp to feature; MODIFIER	silent_mutation	Average:19.345; most accessible tissue: Callus, score: 35.147	N	N	N	N
vg1122183779	T -> C	LOC_Os11g37570.1	upstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:19.345; most accessible tissue: Callus, score: 35.147	N	N	N	N
vg1122183779	T -> C	LOC_Os11g37560.2	upstream_gene_variant ; 4896.0bp to feature; MODIFIER	silent_mutation	Average:19.345; most accessible tissue: Callus, score: 35.147	N	N	N	N
vg1122183779	T -> C	LOC_Os11g37580.1	downstream_gene_variant ; 2685.0bp to feature; MODIFIER	silent_mutation	Average:19.345; most accessible tissue: Callus, score: 35.147	N	N	N	N
vg1122183779	T -> C	LOC_Os11g37570-LOC_Os11g37580	intergenic_region ; MODIFIER	silent_mutation	Average:19.345; most accessible tissue: Callus, score: 35.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122183779	2.13E-06	NA	mr1698	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122183779	NA	1.24E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122183779	6.98E-06	1.18E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122183779	6.35E-06	8.08E-06	mr1990	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251