\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122138317:

Variant ID: vg1122138317 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22138317
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACATGGGCCCCATATGTCATCCTCTCCTTCCGTCTTCCCACTATCCTCTCTCTCTCTCTCTTCTTCCCTACGGGGCGACGGGCGGAGTAGAGCGACGG[C/T]
GGCCGAAGCGGCGGAGCGCGAAGCCAGCAGGGCGGCGGCGGGAATCGGCATCACCTTGGACGTCTTCTCGTCGGAGACCAACGAATGGGCGAAGCGCGAT

Reverse complement sequence

ATCGCGCTTCGCCCATTCGTTGGTCTCCGACGAGAAGACGTCCAAGGTGATGCCGATTCCCGCCGCCGCCCTGCTGGCTTCGCGCTCCGCCGCTTCGGCC[G/A]
CCGTCGCTCTACTCCGCCCGTCGCCCCGTAGGGAAGAAGAGAGAGAGAGAGAGGATAGTGGGAAGACGGAAGGAGAGGATGACATATGGGGCCCATGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 45.30% 0.28% 4.42% NA
All Indica  2759 22.10% 74.20% 0.14% 3.62% NA
All Japonica  1512 95.00% 3.20% 0.33% 1.46% NA
Aus  269 72.90% 2.20% 1.12% 23.79% NA
Indica I  595 42.70% 57.30% 0.00% 0.00% NA
Indica II  465 4.50% 95.30% 0.00% 0.22% NA
Indica III  913 21.50% 71.30% 0.44% 6.79% NA
Indica Intermediate  786 17.60% 77.70% 0.00% 4.71% NA
Temperate Japonica  767 96.10% 3.30% 0.52% 0.13% NA
Tropical Japonica  504 93.70% 3.40% 0.20% 2.78% NA
Japonica Intermediate  241 94.20% 2.90% 0.00% 2.90% NA
VI/Aromatic  96 72.90% 8.30% 1.04% 17.71% NA
Intermediate  90 56.70% 36.70% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122138317 C -> T LOC_Os11g37490.1 upstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg1122138317 C -> T LOC_Os11g37510.1 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg1122138317 C -> T LOC_Os11g37500.1 downstream_gene_variant ; 1697.0bp to feature; MODIFIER silent_mutation Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg1122138317 C -> T LOC_Os11g37500-LOC_Os11g37510 intergenic_region ; MODIFIER silent_mutation Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N
vg1122138317 C -> DEL N N silent_mutation Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122138317 NA 7.65E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 6.93E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 2.77E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 3.33E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 2.80E-06 NA mr1538 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 1.24E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 1.00E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 7.04E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122138317 NA 2.51E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251