\
| Variant ID: vg1122138317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22138317 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTACATGGGCCCCATATGTCATCCTCTCCTTCCGTCTTCCCACTATCCTCTCTCTCTCTCTCTTCTTCCCTACGGGGCGACGGGCGGAGTAGAGCGACGG[C/T]
GGCCGAAGCGGCGGAGCGCGAAGCCAGCAGGGCGGCGGCGGGAATCGGCATCACCTTGGACGTCTTCTCGTCGGAGACCAACGAATGGGCGAAGCGCGAT
ATCGCGCTTCGCCCATTCGTTGGTCTCCGACGAGAAGACGTCCAAGGTGATGCCGATTCCCGCCGCCGCCCTGCTGGCTTCGCGCTCCGCCGCTTCGGCC[G/A]
CCGTCGCTCTACTCCGCCCGTCGCCCCGTAGGGAAGAAGAGAGAGAGAGAGAGGATAGTGGGAAGACGGAAGGAGAGGATGACATATGGGGCCCATGTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 45.30% | 0.28% | 4.42% | NA |
| All Indica | 2759 | 22.10% | 74.20% | 0.14% | 3.62% | NA |
| All Japonica | 1512 | 95.00% | 3.20% | 0.33% | 1.46% | NA |
| Aus | 269 | 72.90% | 2.20% | 1.12% | 23.79% | NA |
| Indica I | 595 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 4.50% | 95.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 21.50% | 71.30% | 0.44% | 6.79% | NA |
| Indica Intermediate | 786 | 17.60% | 77.70% | 0.00% | 4.71% | NA |
| Temperate Japonica | 767 | 96.10% | 3.30% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 93.70% | 3.40% | 0.20% | 2.78% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.90% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 72.90% | 8.30% | 1.04% | 17.71% | NA |
| Intermediate | 90 | 56.70% | 36.70% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122138317 | C -> T | LOC_Os11g37490.1 | upstream_gene_variant ; 3098.0bp to feature; MODIFIER | silent_mutation | Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 | N | N | N | N |
| vg1122138317 | C -> T | LOC_Os11g37510.1 | upstream_gene_variant ; 1601.0bp to feature; MODIFIER | silent_mutation | Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 | N | N | N | N |
| vg1122138317 | C -> T | LOC_Os11g37500.1 | downstream_gene_variant ; 1697.0bp to feature; MODIFIER | silent_mutation | Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 | N | N | N | N |
| vg1122138317 | C -> T | LOC_Os11g37500-LOC_Os11g37510 | intergenic_region ; MODIFIER | silent_mutation | Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 | N | N | N | N |
| vg1122138317 | C -> DEL | N | N | silent_mutation | Average:77.132; most accessible tissue: Minghui63 young leaf, score: 87.057 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122138317 | NA | 7.65E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 6.93E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 2.77E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 3.33E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | 2.80E-06 | NA | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 1.24E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 1.00E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 7.04E-11 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122138317 | NA | 2.51E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |