Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122064371:

Variant ID: vg1122064371 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22064371
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGAAAAGGAAACCGAATTGAAGTAGGAGTATGACTAAGCTCGCCATACAAAACGAAACCCAGGCGACAAAGGGGTTGGTGGATACGACGAACCGCGGAC[A/G]
GGGAGTGAACCGGGAACGGTTCACGACCAATGGAGAGAGAGGAAAGAATTATTAATTTAAATCCTGACATTTAACATTAACAAGGTTATTTTCTCTAATA

Reverse complement sequence

TATTAGAGAAAATAACCTTGTTAATGTTAAATGTCAGGATTTAAATTAATAATTCTTTCCTCTCTCTCCATTGGTCGTGAACCGTTCCCGGTTCACTCCC[T/C]
GTCCGCGGTTCGTCGTATCCACCAACCCCTTTGTCGCCTGGGTTTCGTTTTGTATGGCGAGCTTAGTCATACTCCTACTTCAATTCGGTTTCCTTTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	27.30%	0.19%	4.97%	NA
All Indica	2759	94.50%	1.60%	0.04%	3.88%	NA
All Japonica	1512	16.90%	80.50%	0.20%	2.45%	NA
Aus	269	70.60%	3.70%	1.12%	24.54%	NA
Indica I	595	98.30%	1.50%	0.00%	0.17%	NA
Indica II	465	98.70%	0.90%	0.00%	0.43%	NA
Indica III	913	90.80%	1.80%	0.00%	7.45%	NA
Indica Intermediate	786	93.40%	1.90%	0.13%	4.58%	NA
Temperate Japonica	767	10.60%	88.70%	0.26%	0.52%	NA
Tropical Japonica	504	28.00%	66.90%	0.00%	5.16%	NA
Japonica Intermediate	241	13.70%	83.00%	0.41%	2.90%	NA
VI/Aromatic	96	77.10%	3.10%	0.00%	19.79%	NA
Intermediate	90	71.10%	20.00%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122064371	A -> DEL	N	N	silent_mutation	Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1122064371	A -> G	LOC_Os11g37390.1	upstream_gene_variant ; 3733.0bp to feature; MODIFIER	silent_mutation	Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1122064371	A -> G	LOC_Os11g37380.1	downstream_gene_variant ; 2418.0bp to feature; MODIFIER	silent_mutation	Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg1122064371	A -> G	LOC_Os11g37380-LOC_Os11g37390	intergenic_region ; MODIFIER	silent_mutation	Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122064371	NA	1.04E-54	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122064371	NA	5.79E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	NA	8.24E-24	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	NA	6.99E-06	mr1698	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	NA	5.84E-38	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	NA	4.55E-38	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	NA	1.74E-33	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	3.45E-07	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	7.93E-06	1.14E-08	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	NA	4.94E-23	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122064371	3.03E-07	NA	mr1745_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251