\
| Variant ID: vg1122064371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22064371 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGAAAAGGAAACCGAATTGAAGTAGGAGTATGACTAAGCTCGCCATACAAAACGAAACCCAGGCGACAAAGGGGTTGGTGGATACGACGAACCGCGGAC[A/G]
GGGAGTGAACCGGGAACGGTTCACGACCAATGGAGAGAGAGGAAAGAATTATTAATTTAAATCCTGACATTTAACATTAACAAGGTTATTTTCTCTAATA
TATTAGAGAAAATAACCTTGTTAATGTTAAATGTCAGGATTTAAATTAATAATTCTTTCCTCTCTCTCCATTGGTCGTGAACCGTTCCCGGTTCACTCCC[T/C]
GTCCGCGGTTCGTCGTATCCACCAACCCCTTTGTCGCCTGGGTTTCGTTTTGTATGGCGAGCTTAGTCATACTCCTACTTCAATTCGGTTTCCTTTTCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 27.30% | 0.19% | 4.97% | NA |
| All Indica | 2759 | 94.50% | 1.60% | 0.04% | 3.88% | NA |
| All Japonica | 1512 | 16.90% | 80.50% | 0.20% | 2.45% | NA |
| Aus | 269 | 70.60% | 3.70% | 1.12% | 24.54% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.00% | 0.17% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.00% | 0.43% | NA |
| Indica III | 913 | 90.80% | 1.80% | 0.00% | 7.45% | NA |
| Indica Intermediate | 786 | 93.40% | 1.90% | 0.13% | 4.58% | NA |
| Temperate Japonica | 767 | 10.60% | 88.70% | 0.26% | 0.52% | NA |
| Tropical Japonica | 504 | 28.00% | 66.90% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 13.70% | 83.00% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 71.10% | 20.00% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122064371 | A -> DEL | N | N | silent_mutation | Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1122064371 | A -> G | LOC_Os11g37390.1 | upstream_gene_variant ; 3733.0bp to feature; MODIFIER | silent_mutation | Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1122064371 | A -> G | LOC_Os11g37380.1 | downstream_gene_variant ; 2418.0bp to feature; MODIFIER | silent_mutation | Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1122064371 | A -> G | LOC_Os11g37380-LOC_Os11g37390 | intergenic_region ; MODIFIER | silent_mutation | Average:51.951; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122064371 | NA | 1.04E-54 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1122064371 | NA | 5.79E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | NA | 8.24E-24 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | NA | 6.99E-06 | mr1698 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | NA | 5.84E-38 | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | NA | 4.55E-38 | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | NA | 1.74E-33 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | 3.45E-07 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | 7.93E-06 | 1.14E-08 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | NA | 4.94E-23 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122064371 | 3.03E-07 | NA | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |