\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122054525:

Variant ID: vg1122054525 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22054525
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGAGGAATGAAAAAAGGAAGAGAGAGGGGTGAGGGGGAGAGAAGCTGATAGGTGGGTTTCAACGATTATTTTTTTAAAAAAAAATGTTGATTTTTGAG[T/C]
AGGACGGTAATTCATCCGGTTTTACAAGTTTAGGGTGTGAAATATCTGGTATTTGAGTTTTGCGGGGTAATTCGATCGACCGCGATAGTTTAAGGGGTAA

Reverse complement sequence

TTACCCCTTAAACTATCGCGGTCGATCGAATTACCCCGCAAAACTCAAATACCAGATATTTCACACCCTAAACTTGTAAAACCGGATGAATTACCGTCCT[A/G]
CTCAAAAATCAACATTTTTTTTTAAAAAAATAATCGTTGAAACCCACCTATCAGCTTCTCTCCCCCTCACCCCTCTCTCTTCCTTTTTTCATTCCTCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.90% 14.50% 0.47% 5.06% NA
All Indica  2759 94.90% 0.50% 0.65% 3.91% NA
All Japonica  1512 54.00% 43.40% 0.13% 2.51% NA
Aus  269 71.70% 1.90% 0.74% 25.65% NA
Indica I  595 99.00% 0.70% 0.00% 0.34% NA
Indica II  465 98.90% 0.40% 0.22% 0.43% NA
Indica III  913 92.00% 0.40% 0.22% 7.34% NA
Indica Intermediate  786 92.70% 0.60% 1.91% 4.71% NA
Temperate Japonica  767 32.70% 66.50% 0.26% 0.52% NA
Tropical Japonica  504 81.50% 13.10% 0.00% 5.36% NA
Japonica Intermediate  241 63.90% 33.20% 0.00% 2.90% NA
VI/Aromatic  96 78.10% 3.10% 0.00% 18.75% NA
Intermediate  90 84.40% 8.90% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122054525 T -> DEL N N silent_mutation Average:59.016; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1122054525 T -> C LOC_Os11g37350.1 upstream_gene_variant ; 4525.0bp to feature; MODIFIER silent_mutation Average:59.016; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1122054525 T -> C LOC_Os11g37370.1 upstream_gene_variant ; 540.0bp to feature; MODIFIER silent_mutation Average:59.016; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1122054525 T -> C LOC_Os11g37360.1 downstream_gene_variant ; 1328.0bp to feature; MODIFIER silent_mutation Average:59.016; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg1122054525 T -> C LOC_Os11g37360-LOC_Os11g37370 intergenic_region ; MODIFIER silent_mutation Average:59.016; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122054525 NA 9.02E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 3.37E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 7.86E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.73E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 4.37E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 9.87E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 2.46E-07 2.79E-11 mr1539 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 7.13E-13 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.39E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.27E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 9.65E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 7.45E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 6.25E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 6.31E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 9.89E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 4.35E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.19E-12 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 4.83E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 4.62E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.91E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 7.21E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 3.42E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.89E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 1.52E-06 2.03E-19 mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 8.36E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.93E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 3.61E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 NA 1.28E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054525 7.42E-06 1.81E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251