\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122054372:

Variant ID: vg1122054372 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22054372
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACGTTTCCGCCTCCCGCCACCTCCACTGTCCTCCTTGGCGCCTCGCCACCCACCGCGCCCTCCCAGCGACGCTTCTGCCTACCGCCCGTGCCATCCTG[A/C]
CAACACCGCCATCCTCCACTGTCCTCACCACCCACGACGCCACAGAGATGAGAGAGAGGAATGAAAAAAGGAAGAGAGAGGGGTGAGGGGGAGAGAAGCT

Reverse complement sequence

AGCTTCTCTCCCCCTCACCCCTCTCTCTTCCTTTTTTCATTCCTCTCTCTCATCTCTGTGGCGTCGTGGGTGGTGAGGACAGTGGAGGATGGCGGTGTTG[T/G]
CAGGATGGCACGGGCGGTAGGCAGAAGCGTCGCTGGGAGGGCGCGGTGGGTGGCGAGGCGCCAAGGAGGACAGTGGAGGTGGCGGGAGGCGGAAACGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 21.30% 0.21% 4.89% NA
All Indica  2759 85.40% 10.60% 0.25% 3.77% NA
All Japonica  1512 53.80% 43.70% 0.07% 2.45% NA
Aus  269 59.90% 14.90% 0.37% 24.91% NA
Indica I  595 91.80% 7.90% 0.17% 0.17% NA
Indica II  465 97.00% 2.60% 0.00% 0.43% NA
Indica III  913 78.20% 14.30% 0.44% 7.01% NA
Indica Intermediate  786 82.10% 13.00% 0.25% 4.71% NA
Temperate Japonica  767 31.90% 67.50% 0.13% 0.39% NA
Tropical Japonica  504 82.10% 12.50% 0.00% 5.36% NA
Japonica Intermediate  241 63.90% 33.20% 0.00% 2.90% NA
VI/Aromatic  96 77.10% 4.20% 1.04% 17.71% NA
Intermediate  90 81.10% 12.20% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122054372 A -> DEL N N silent_mutation Average:73.796; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1122054372 A -> C LOC_Os11g37350.1 upstream_gene_variant ; 4372.0bp to feature; MODIFIER silent_mutation Average:73.796; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1122054372 A -> C LOC_Os11g37370.1 upstream_gene_variant ; 693.0bp to feature; MODIFIER silent_mutation Average:73.796; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1122054372 A -> C LOC_Os11g37360.1 downstream_gene_variant ; 1175.0bp to feature; MODIFIER silent_mutation Average:73.796; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N
vg1122054372 A -> C LOC_Os11g37360-LOC_Os11g37370 intergenic_region ; MODIFIER silent_mutation Average:73.796; most accessible tissue: Zhenshan97 young leaf, score: 83.199 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122054372 A C -0.01 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122054372 NA 2.98E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 1.51E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 3.52E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 7.19E-06 7.18E-06 mr1160 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 1.15E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 3.02E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 2.11E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 5.98E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 1.21E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 4.23E-06 1.25E-13 mr1540 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 2.52E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 2.11E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 7.40E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 8.11E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 5.75E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 1.75E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 1.42E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 3.40E-07 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 6.58E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 7.87E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 1.37E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 4.23E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122054372 NA 7.82E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251