Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122051649:

Variant ID: vg1122051649 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22051649
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAGGAAGAAGTCCACATTTTTCCACCCCATCTCGGGAGAGCATTCACATGATTACAAAGAGGAGGCAGGAGCCGCAGGATAGCCTTGTTTAGTTCCCAA[T/A]
TTTTTTTTCCCAAAAACGTCGCATCGAATCTTTGGACATATACATGGAGCATTAAATATAGATAAAATGAAAAATTAATTGTATAGTTTGCATGGAAATC

Reverse complement sequence

GATTTCCATGCAAACTATACAATTAATTTTTCATTTTATCTATATTTAATGCTCCATGTATATGTCCAAAGATTCGATGCGACGTTTTTGGGAAAAAAAA[A/T]
TTGGGAACTAAACAAGGCTATCCTGCGGCTCCTGCCTCCTCTTTGTAATCATGTGAATGCTCTCCCGAGATGGGGTGGAAAAATGTGGACTTCTTCCTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	21.30%	3.00%	8.82%	NA
All Indica	2759	87.90%	4.20%	3.70%	4.20%	NA
All Japonica	1512	40.60%	55.40%	0.40%	3.57%	NA
Aus	269	18.60%	12.30%	10.41%	58.74%	NA
Indica I	595	84.20%	6.40%	8.91%	0.50%	NA
Indica II	465	98.10%	1.30%	0.22%	0.43%	NA
Indica III	913	84.10%	4.80%	3.29%	7.78%	NA
Indica Intermediate	786	89.10%	3.60%	2.29%	5.09%	NA
Temperate Japonica	767	21.50%	75.70%	0.52%	2.22%	NA
Tropical Japonica	504	69.60%	24.60%	0.20%	5.56%	NA
Japonica Intermediate	241	40.70%	55.20%	0.41%	3.73%	NA
VI/Aromatic	96	15.60%	6.20%	2.08%	76.04%	NA
Intermediate	90	61.10%	16.70%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122051649	T -> A	LOC_Os11g37350.1	upstream_gene_variant ; 1649.0bp to feature; MODIFIER	silent_mutation	Average:45.678; most accessible tissue: Callus, score: 75.021	N	N	N	N
vg1122051649	T -> A	LOC_Os11g37360.1	upstream_gene_variant ; 919.0bp to feature; MODIFIER	silent_mutation	Average:45.678; most accessible tissue: Callus, score: 75.021	N	N	N	N
vg1122051649	T -> A	LOC_Os11g37370.1	upstream_gene_variant ; 3416.0bp to feature; MODIFIER	silent_mutation	Average:45.678; most accessible tissue: Callus, score: 75.021	N	N	N	N
vg1122051649	T -> A	LOC_Os11g37340.1	downstream_gene_variant ; 4807.0bp to feature; MODIFIER	silent_mutation	Average:45.678; most accessible tissue: Callus, score: 75.021	N	N	N	N
vg1122051649	T -> A	LOC_Os11g37350-LOC_Os11g37360	intergenic_region ; MODIFIER	silent_mutation	Average:45.678; most accessible tissue: Callus, score: 75.021	N	N	N	N
vg1122051649	T -> DEL	N	N	silent_mutation	Average:45.678; most accessible tissue: Callus, score: 75.021	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122051649	NA	3.93E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	7.75E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	7.65E-06	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	1.89E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	8.65E-08	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	2.86E-07	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	3.19E-07	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	9.38E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	3.15E-11	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	8.24E-07	NA	mr1970_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	3.74E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	1.29E-08	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649	NA	5.48E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251