\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122051649:

Variant ID: vg1122051649 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22051649
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGGAAGAAGTCCACATTTTTCCACCCCATCTCGGGAGAGCATTCACATGATTACAAAGAGGAGGCAGGAGCCGCAGGATAGCCTTGTTTAGTTCCCAA[T/A]
TTTTTTTTCCCAAAAACGTCGCATCGAATCTTTGGACATATACATGGAGCATTAAATATAGATAAAATGAAAAATTAATTGTATAGTTTGCATGGAAATC

Reverse complement sequence

GATTTCCATGCAAACTATACAATTAATTTTTCATTTTATCTATATTTAATGCTCCATGTATATGTCCAAAGATTCGATGCGACGTTTTTGGGAAAAAAAA[A/T]
TTGGGAACTAAACAAGGCTATCCTGCGGCTCCTGCCTCCTCTTTGTAATCATGTGAATGCTCTCCCGAGATGGGGTGGAAAAATGTGGACTTCTTCCTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 21.30% 3.00% 8.82% NA
All Indica  2759 87.90% 4.20% 3.70% 4.20% NA
All Japonica  1512 40.60% 55.40% 0.40% 3.57% NA
Aus  269 18.60% 12.30% 10.41% 58.74% NA
Indica I  595 84.20% 6.40% 8.91% 0.50% NA
Indica II  465 98.10% 1.30% 0.22% 0.43% NA
Indica III  913 84.10% 4.80% 3.29% 7.78% NA
Indica Intermediate  786 89.10% 3.60% 2.29% 5.09% NA
Temperate Japonica  767 21.50% 75.70% 0.52% 2.22% NA
Tropical Japonica  504 69.60% 24.60% 0.20% 5.56% NA
Japonica Intermediate  241 40.70% 55.20% 0.41% 3.73% NA
VI/Aromatic  96 15.60% 6.20% 2.08% 76.04% NA
Intermediate  90 61.10% 16.70% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122051649 T -> A LOC_Os11g37350.1 upstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:45.678; most accessible tissue: Callus, score: 75.021 N N N N
vg1122051649 T -> A LOC_Os11g37360.1 upstream_gene_variant ; 919.0bp to feature; MODIFIER silent_mutation Average:45.678; most accessible tissue: Callus, score: 75.021 N N N N
vg1122051649 T -> A LOC_Os11g37370.1 upstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:45.678; most accessible tissue: Callus, score: 75.021 N N N N
vg1122051649 T -> A LOC_Os11g37340.1 downstream_gene_variant ; 4807.0bp to feature; MODIFIER silent_mutation Average:45.678; most accessible tissue: Callus, score: 75.021 N N N N
vg1122051649 T -> A LOC_Os11g37350-LOC_Os11g37360 intergenic_region ; MODIFIER silent_mutation Average:45.678; most accessible tissue: Callus, score: 75.021 N N N N
vg1122051649 T -> DEL N N silent_mutation Average:45.678; most accessible tissue: Callus, score: 75.021 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122051649 NA 3.93E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 7.75E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 7.65E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 1.89E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 8.65E-08 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 2.86E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 3.19E-07 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 9.38E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 3.15E-11 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 8.24E-07 NA mr1970_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 3.74E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 1.29E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051649 NA 5.48E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251