\
| Variant ID: vg1122051649 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22051649 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAGGAAGAAGTCCACATTTTTCCACCCCATCTCGGGAGAGCATTCACATGATTACAAAGAGGAGGCAGGAGCCGCAGGATAGCCTTGTTTAGTTCCCAA[T/A]
TTTTTTTTCCCAAAAACGTCGCATCGAATCTTTGGACATATACATGGAGCATTAAATATAGATAAAATGAAAAATTAATTGTATAGTTTGCATGGAAATC
GATTTCCATGCAAACTATACAATTAATTTTTCATTTTATCTATATTTAATGCTCCATGTATATGTCCAAAGATTCGATGCGACGTTTTTGGGAAAAAAAA[A/T]
TTGGGAACTAAACAAGGCTATCCTGCGGCTCCTGCCTCCTCTTTGTAATCATGTGAATGCTCTCCCGAGATGGGGTGGAAAAATGTGGACTTCTTCCTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 21.30% | 3.00% | 8.82% | NA |
| All Indica | 2759 | 87.90% | 4.20% | 3.70% | 4.20% | NA |
| All Japonica | 1512 | 40.60% | 55.40% | 0.40% | 3.57% | NA |
| Aus | 269 | 18.60% | 12.30% | 10.41% | 58.74% | NA |
| Indica I | 595 | 84.20% | 6.40% | 8.91% | 0.50% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 84.10% | 4.80% | 3.29% | 7.78% | NA |
| Indica Intermediate | 786 | 89.10% | 3.60% | 2.29% | 5.09% | NA |
| Temperate Japonica | 767 | 21.50% | 75.70% | 0.52% | 2.22% | NA |
| Tropical Japonica | 504 | 69.60% | 24.60% | 0.20% | 5.56% | NA |
| Japonica Intermediate | 241 | 40.70% | 55.20% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 15.60% | 6.20% | 2.08% | 76.04% | NA |
| Intermediate | 90 | 61.10% | 16.70% | 4.44% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122051649 | T -> A | LOC_Os11g37350.1 | upstream_gene_variant ; 1649.0bp to feature; MODIFIER | silent_mutation | Average:45.678; most accessible tissue: Callus, score: 75.021 | N | N | N | N |
| vg1122051649 | T -> A | LOC_Os11g37360.1 | upstream_gene_variant ; 919.0bp to feature; MODIFIER | silent_mutation | Average:45.678; most accessible tissue: Callus, score: 75.021 | N | N | N | N |
| vg1122051649 | T -> A | LOC_Os11g37370.1 | upstream_gene_variant ; 3416.0bp to feature; MODIFIER | silent_mutation | Average:45.678; most accessible tissue: Callus, score: 75.021 | N | N | N | N |
| vg1122051649 | T -> A | LOC_Os11g37340.1 | downstream_gene_variant ; 4807.0bp to feature; MODIFIER | silent_mutation | Average:45.678; most accessible tissue: Callus, score: 75.021 | N | N | N | N |
| vg1122051649 | T -> A | LOC_Os11g37350-LOC_Os11g37360 | intergenic_region ; MODIFIER | silent_mutation | Average:45.678; most accessible tissue: Callus, score: 75.021 | N | N | N | N |
| vg1122051649 | T -> DEL | N | N | silent_mutation | Average:45.678; most accessible tissue: Callus, score: 75.021 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122051649 | NA | 3.93E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 7.75E-06 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 7.65E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 1.89E-08 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 8.65E-08 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 2.86E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 3.19E-07 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 9.38E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 3.15E-11 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | 8.24E-07 | NA | mr1970_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 3.74E-06 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 1.29E-08 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122051649 | NA | 5.48E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |