Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122051014:

Variant ID: vg1122051014 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22051014
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, C: 0.27, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAAGAGGAGTTTGACACAAACTGCATAGTGATGACATATGGATGGCTTTCAATCATGGTACCAGTTGCAACACTACTGTTCCAAATGACAATTAAA[C/A]
CCCCTGAGTTTCCAAAAGAAGGTTGAAAAACAAACTTATCAAACCTTCTAGGACAAAATTTTCTAATATAGGAGTGGTCAAAATGCTCTCTTTTGGTTTC

Reverse complement sequence

GAAACCAAAAGAGAGCATTTTGACCACTCCTATATTAGAAAATTTTGTCCTAGAAGGTTTGATAAGTTTGTTTTTCAACCTTCTTTTGGAAACTCAGGGG[G/T]
TTTAATTGTCATTTGGAACAGTAGTGTTGCAACTGGTACCATGATTGAAAGCCATCCATATGTCATCACTATGCAGTTTGTGTCAAACTCCTCTTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	34.10%	0.51%	4.91%	NA
All Indica	2759	84.00%	11.60%	0.69%	3.77%	NA
All Japonica	1512	16.70%	80.60%	0.20%	2.45%	NA
Aus	269	58.40%	16.00%	0.37%	25.28%	NA
Indica I	595	90.80%	8.70%	0.17%	0.34%	NA
Indica II	465	96.60%	3.00%	0.00%	0.43%	NA
Indica III	913	77.30%	15.20%	0.44%	7.01%	NA
Indica Intermediate	786	79.10%	14.50%	1.78%	4.58%	NA
Temperate Japonica	767	9.00%	90.20%	0.26%	0.52%	NA
Tropical Japonica	504	29.40%	65.30%	0.20%	5.16%	NA
Japonica Intermediate	241	14.90%	82.20%	0.00%	2.90%	NA
VI/Aromatic	96	77.10%	4.20%	0.00%	18.75%	NA
Intermediate	90	65.60%	27.80%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122051014	C -> A	LOC_Os11g37350.1	upstream_gene_variant ; 1014.0bp to feature; MODIFIER	silent_mutation	Average:33.438; most accessible tissue: Callus, score: 76.663	N	N	N	N
vg1122051014	C -> A	LOC_Os11g37360.1	upstream_gene_variant ; 1554.0bp to feature; MODIFIER	silent_mutation	Average:33.438; most accessible tissue: Callus, score: 76.663	N	N	N	N
vg1122051014	C -> A	LOC_Os11g37370.1	upstream_gene_variant ; 4051.0bp to feature; MODIFIER	silent_mutation	Average:33.438; most accessible tissue: Callus, score: 76.663	N	N	N	N
vg1122051014	C -> A	LOC_Os11g37340.1	downstream_gene_variant ; 4172.0bp to feature; MODIFIER	silent_mutation	Average:33.438; most accessible tissue: Callus, score: 76.663	N	N	N	N
vg1122051014	C -> A	LOC_Os11g37350-LOC_Os11g37360	intergenic_region ; MODIFIER	silent_mutation	Average:33.438; most accessible tissue: Callus, score: 76.663	N	N	N	N
vg1122051014	C -> DEL	N	N	silent_mutation	Average:33.438; most accessible tissue: Callus, score: 76.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122051014	1.82E-06	1.82E-06	mr1160	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051014	NA	3.93E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051014	NA	2.10E-06	mr1698	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051014	NA	6.39E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051014	NA	2.70E-07	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122051014	6.80E-06	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251