\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122032106:

Variant ID: vg1122032106 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 22032106
Reference Allele: CAlternative Allele: A,CAA,CA
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATAAATAATTTTTTCTGCTCTCTTTTCTATATTTTTACTCAATAATTATGGGCCCACCTAACTGCCATCCAAAGTAGAGGCAAACGGCTGATTTGTTT[C/A,CAA,CA]
AAAAAAGCTGGGGTAAAATCACAAACCCTAAAAAATAGGGGTAAAATCATAATTAGAATTGAAAGTGAGGGTAAGAACGCAATTGTCCCTAAATTTAAAT

Reverse complement sequence

ATTTAAATTTAGGGACAATTGCGTTCTTACCCTCACTTTCAATTCTAATTATGATTTTACCCCTATTTTTTAGGGTTTGTGATTTTACCCCAGCTTTTTT[G/T,TTG,TG]
AAACAAATCAGCCGTTTGCCTCTACTTTGGATGGCAGTTAGGTGGGCCCATAATTATTGAGTAAAAATATAGAAAAGAGAGCAGAAAAAATTATTTATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.70% 23.90% 6.88% 19.89% CAA: 3.98%; CA: 2.67%
All Indica  2759 61.30% 2.20% 8.12% 23.78% CA: 4.49%; CAA: 0.11%
All Japonica  1512 4.60% 68.80% 5.75% 8.99% CAA: 11.84%; CA: 0.07%
Aus  269 55.80% 3.30% 1.86% 39.03% NA
Indica I  595 40.80% 2.00% 7.56% 46.72% CA: 2.86%
Indica II  465 66.00% 1.50% 9.68% 22.37% CA: 0.22%; CAA: 0.22%
Indica III  913 71.40% 2.30% 7.67% 12.49% CA: 6.13%
Indica Intermediate  786 62.20% 2.70% 8.14% 20.36% CA: 6.36%; CAA: 0.25%
Temperate Japonica  767 6.50% 79.70% 1.69% 3.78% CAA: 8.34%
Tropical Japonica  504 2.40% 56.00% 11.71% 17.46% CAA: 12.50%
Japonica Intermediate  241 2.90% 61.00% 6.22% 7.88% CAA: 21.58%; CA: 0.41%
VI/Aromatic  96 71.90% 2.10% 2.08% 23.96% NA
Intermediate  90 44.40% 17.80% 7.78% 22.22% CAA: 6.67%; CA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122032106 C -> CA LOC_Os11g37310.1 upstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> CA LOC_Os11g37300.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> CA LOC_Os11g37300-LOC_Os11g37310 intergenic_region ; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> A LOC_Os11g37310.1 upstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> A LOC_Os11g37300.1 downstream_gene_variant ; 2358.0bp to feature; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> A LOC_Os11g37300-LOC_Os11g37310 intergenic_region ; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> CAA LOC_Os11g37310.1 upstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> CAA LOC_Os11g37300.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> CAA LOC_Os11g37300-LOC_Os11g37310 intergenic_region ; MODIFIER silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N
vg1122032106 C -> DEL N N silent_mutation Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122032106 NA 1.17E-20 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 5.40E-06 mr1698 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 5.10E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 1.94E-06 NA mr1120_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 6.78E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 4.64E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 2.25E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 1.69E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 5.31E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 1.97E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 2.17E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 6.76E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032106 NA 6.27E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251