\
| Variant ID: vg1122032106 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 22032106 |
| Reference Allele: C | Alternative Allele: A,CAA,CA |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCATAAATAATTTTTTCTGCTCTCTTTTCTATATTTTTACTCAATAATTATGGGCCCACCTAACTGCCATCCAAAGTAGAGGCAAACGGCTGATTTGTTT[C/A,CAA,CA]
AAAAAAGCTGGGGTAAAATCACAAACCCTAAAAAATAGGGGTAAAATCATAATTAGAATTGAAAGTGAGGGTAAGAACGCAATTGTCCCTAAATTTAAAT
ATTTAAATTTAGGGACAATTGCGTTCTTACCCTCACTTTCAATTCTAATTATGATTTTACCCCTATTTTTTAGGGTTTGTGATTTTACCCCAGCTTTTTT[G/T,TTG,TG]
AAACAAATCAGCCGTTTGCCTCTACTTTGGATGGCAGTTAGGTGGGCCCATAATTATTGAGTAAAAATATAGAAAAGAGAGCAGAAAAAATTATTTATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.70% | 23.90% | 6.88% | 19.89% | CAA: 3.98%; CA: 2.67% |
| All Indica | 2759 | 61.30% | 2.20% | 8.12% | 23.78% | CA: 4.49%; CAA: 0.11% |
| All Japonica | 1512 | 4.60% | 68.80% | 5.75% | 8.99% | CAA: 11.84%; CA: 0.07% |
| Aus | 269 | 55.80% | 3.30% | 1.86% | 39.03% | NA |
| Indica I | 595 | 40.80% | 2.00% | 7.56% | 46.72% | CA: 2.86% |
| Indica II | 465 | 66.00% | 1.50% | 9.68% | 22.37% | CA: 0.22%; CAA: 0.22% |
| Indica III | 913 | 71.40% | 2.30% | 7.67% | 12.49% | CA: 6.13% |
| Indica Intermediate | 786 | 62.20% | 2.70% | 8.14% | 20.36% | CA: 6.36%; CAA: 0.25% |
| Temperate Japonica | 767 | 6.50% | 79.70% | 1.69% | 3.78% | CAA: 8.34% |
| Tropical Japonica | 504 | 2.40% | 56.00% | 11.71% | 17.46% | CAA: 12.50% |
| Japonica Intermediate | 241 | 2.90% | 61.00% | 6.22% | 7.88% | CAA: 21.58%; CA: 0.41% |
| VI/Aromatic | 96 | 71.90% | 2.10% | 2.08% | 23.96% | NA |
| Intermediate | 90 | 44.40% | 17.80% | 7.78% | 22.22% | CAA: 6.67%; CA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122032106 | C -> CA | LOC_Os11g37310.1 | upstream_gene_variant ; 712.0bp to feature; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> CA | LOC_Os11g37300.1 | downstream_gene_variant ; 2359.0bp to feature; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> CA | LOC_Os11g37300-LOC_Os11g37310 | intergenic_region ; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> A | LOC_Os11g37310.1 | upstream_gene_variant ; 713.0bp to feature; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> A | LOC_Os11g37300.1 | downstream_gene_variant ; 2358.0bp to feature; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> A | LOC_Os11g37300-LOC_Os11g37310 | intergenic_region ; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> CAA | LOC_Os11g37310.1 | upstream_gene_variant ; 712.0bp to feature; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> CAA | LOC_Os11g37300.1 | downstream_gene_variant ; 2359.0bp to feature; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> CAA | LOC_Os11g37300-LOC_Os11g37310 | intergenic_region ; MODIFIER | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| vg1122032106 | C -> DEL | N | N | silent_mutation | Average:80.409; most accessible tissue: Minghui63 panicle, score: 90.833 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122032106 | NA | 1.17E-20 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 5.40E-06 | mr1698 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | 5.10E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | 1.94E-06 | NA | mr1120_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | 6.78E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | 4.64E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 2.25E-12 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 1.69E-06 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 5.31E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 1.97E-08 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 2.17E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | 6.76E-06 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122032106 | NA | 6.27E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |