\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122024114:

Variant ID: vg1122024114 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22024114
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGTCTGTAATGGGCCTATAGGTCTGTAACTTCGTCTGGGACCCTGGTCCAAGGGGGGCTGTGCCCTAAACAGAGGGAGGACGCCCTTATGACCTCCTC[T/C]
ATCCTTTAAATAGCTAGTAACCCCTTCAGGGTTAGTTGGGTTTTGATTAATTGTAAGTTTAGCTATTGCTACTTCGCTTGTAGCACGCGTGTCGGCTAGA

Reverse complement sequence

TCTAGCCGACACGCGTGCTACAAGCGAAGTAGCAATAGCTAAACTTACAATTAATCAAAACCCAACTAACCCTGAAGGGGTTACTAGCTATTTAAAGGAT[A/G]
GAGGAGGTCATAAGGGCGTCCTCCCTCTGTTTAGGGCACAGCCCCCCTTGGACCAGGGTCCCAGACGAAGTTACAGACCTATAGGCCCATTACAGACAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 13.80% 0.17% 5.14% NA
All Indica  2759 95.30% 0.70% 0.11% 3.95% NA
All Japonica  1512 56.00% 41.20% 0.26% 2.58% NA
Aus  269 72.10% 1.50% 0.00% 26.39% NA
Indica I  595 98.70% 0.80% 0.34% 0.17% NA
Indica II  465 99.10% 0.40% 0.00% 0.43% NA
Indica III  913 92.10% 0.40% 0.00% 7.45% NA
Indica Intermediate  786 94.10% 0.90% 0.13% 4.83% NA
Temperate Japonica  767 34.40% 64.40% 0.52% 0.65% NA
Tropical Japonica  504 85.70% 8.90% 0.00% 5.36% NA
Japonica Intermediate  241 62.20% 34.90% 0.00% 2.90% NA
VI/Aromatic  96 80.20% 0.00% 1.04% 18.75% NA
Intermediate  90 85.60% 7.80% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122024114 T -> DEL N N silent_mutation Average:45.583; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg1122024114 T -> C LOC_Os11g37290.1 upstream_gene_variant ; 2545.0bp to feature; MODIFIER silent_mutation Average:45.583; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg1122024114 T -> C LOC_Os11g37300.1 upstream_gene_variant ; 1646.0bp to feature; MODIFIER silent_mutation Average:45.583; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg1122024114 T -> C LOC_Os11g37290-LOC_Os11g37300 intergenic_region ; MODIFIER silent_mutation Average:45.583; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122024114 NA 5.98E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 6.06E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 3.52E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 5.60E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 3.84E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 1.09E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 4.82E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 2.39E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 2.66E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 4.26E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 2.44E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 2.14E-06 2.14E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 3.14E-06 2.79E-08 mr1736 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 2.51E-07 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 7.49E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 2.66E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 4.61E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 1.19E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 3.26E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 5.87E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 1.58E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 1.08E-16 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122024114 NA 1.54E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251