| Variant ID: vg1122001659 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 22001659 |
| Reference Allele: C | Alternative Allele: A,T,CA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGTTCATTAGCAGCACGTGATTAATTAAGTATTAGCTAATTTTTTTTAAGAATGGATCAATATGATTTTTTTAAGGAACTTTTGTACAGAAACTTTTTG[C/A,T,CA]
AAAAAAACGTATCGTATATCGTTTAACAGTTTGAAAAGCGTGCGGGCAAAAAACGAGGGAGATGAGTTGGAAAACCTAGGTAAGAACACAGCCTATATGT
ACATATAGGCTGTGTTCTTACCTAGGTTTTCCAACTCATCTCCCTCGTTTTTTGCCCGCACGCTTTTCAAACTGTTAAACGATATACGATACGTTTTTTT[G/T,A,TG]
CAAAAAGTTTCTGTACAAAAGTTCCTTAAAAAAATCATATTGATCCATTCTTAAAAAAAATTAGCTAATACTTAATTAATCACGTGCTGCTAATGAACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.50% | 2.20% | 17.14% | 31.02% | A: 1.08%; CA: 0.06% |
| All Indica | 2759 | 43.00% | 0.10% | 24.50% | 32.11% | A: 0.25%; CA: 0.04% |
| All Japonica | 1512 | 66.50% | 6.60% | 6.61% | 19.11% | A: 1.12% |
| Aus | 269 | 20.10% | 1.10% | 4.46% | 64.31% | A: 9.29%; CA: 0.74% |
| Indica I | 595 | 54.50% | 0.00% | 20.84% | 24.71% | NA |
| Indica II | 465 | 19.60% | 0.00% | 33.98% | 46.24% | A: 0.22% |
| Indica III | 913 | 53.20% | 0.00% | 17.96% | 28.59% | A: 0.11%; CA: 0.11% |
| Indica Intermediate | 786 | 36.40% | 0.30% | 29.26% | 33.46% | A: 0.64% |
| Temperate Japonica | 767 | 82.50% | 1.40% | 3.91% | 11.99% | A: 0.13% |
| Tropical Japonica | 504 | 53.20% | 5.80% | 12.10% | 25.99% | A: 2.98% |
| Japonica Intermediate | 241 | 43.60% | 24.90% | 3.73% | 27.39% | A: 0.41% |
| VI/Aromatic | 96 | 7.30% | 0.00% | 5.21% | 87.50% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 18.89% | 37.78% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122001659 | C -> T | LOC_Os11g37260.1 | upstream_gene_variant ; 1709.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> T | LOC_Os11g37240.1 | downstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> T | LOC_Os11g37250.1 | downstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> T | LOC_Os11g37250-LOC_Os11g37260 | intergenic_region ; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> A | LOC_Os11g37260.1 | upstream_gene_variant ; 1709.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> A | LOC_Os11g37240.1 | downstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> A | LOC_Os11g37250.1 | downstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> A | LOC_Os11g37250-LOC_Os11g37260 | intergenic_region ; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> CA | LOC_Os11g37260.1 | upstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> CA | LOC_Os11g37240.1 | downstream_gene_variant ; 3142.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> CA | LOC_Os11g37250.1 | downstream_gene_variant ; 91.0bp to feature; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> CA | LOC_Os11g37250-LOC_Os11g37260 | intergenic_region ; MODIFIER | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122001659 | C -> DEL | N | N | silent_mutation | Average:59.529; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122001659 | NA | 8.98E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122001659 | NA | 5.80E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122001659 | 1.67E-06 | 2.73E-07 | mr1736 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122001659 | NA | 4.49E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122001659 | NA | 3.76E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |