\
| Variant ID: vg1121984717 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21984717 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 209. )
CCAACACCATACAAGATGCTTTTTCCCTCAAAAATACCATACAAAAGTGTTTGTTAAGCGGAATTCTCAATTTTGTTTTTTTTTTTTTGGACAACCTCTA[T/C]
AAGTTTTGCATGTAACTGTTGGAACTACATATTGTGTGCTGAATTTATTTTCAATTACTGTTTTCTTTCTTGTCTGTTGTATCATTTAGCCATCACATGT
ACATGTGATGGCTAAATGATACAACAGACAAGAAAGAAAACAGTAATTGAAAATAAATTCAGCACACAATATGTAGTTCCAACAGTTACATGCAAAACTT[A/G]
TAGAGGTTGTCCAAAAAAAAAAAAACAAAATTGAGAATTCCGCTTAACAAACACTTTTGTATGGTATTTTTGAGGGAAAAAGCATCTTGTATGGTGTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.00% | 27.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.50% | 65.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 82.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121984717 | T -> C | LOC_Os11g37210.1 | downstream_gene_variant ; 1931.0bp to feature; MODIFIER | silent_mutation | Average:58.093; most accessible tissue: Callus, score: 82.469 | N | N | N | N |
| vg1121984717 | T -> C | LOC_Os11g37200.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.093; most accessible tissue: Callus, score: 82.469 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121984717 | NA | 1.25E-55 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1121984717 | NA | 1.51E-42 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 4.32E-24 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 3.28E-06 | mr1698 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | 9.40E-07 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 1.03E-34 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 9.23E-34 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | 4.10E-06 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 1.38E-07 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 6.14E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | 9.99E-07 | 7.00E-26 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | NA | 2.18E-06 | mr1698_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121984717 | 1.15E-07 | NA | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |