Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121977578:

Variant ID: vg1121977578 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 21977578
Reference Allele: G	Alternative Allele: T,GTC
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTGATACTTGTGAGAGATACTGTGTGCCACTACTAACTTTCTCACAGACACACGAGACAAAGAGATACAGATGGATACCGCTGGGGATATATTGGGTT[G/T,GTC]
TCGCACCTTTTTCGTGCAGCTTACAAGAAATATATATCGGAGAAATCTAGCCGTCCTAATAGGCAATTAATCCTATAATGCAGAGTCCTATTAAAAAACT

Reverse complement sequence

AGTTTTTTAATAGGACTCTGCATTATAGGATTAATTGCCTATTAGGACGGCTAGATTTCTCCGATATATATTTCTTGTAAGCTGCACGAAAAAGGTGCGA[C/A,GAC]
AACCCAATATATCCCCAGCGGTATCCATCTGTATCTCTTTGTCTCGTGTGTCTGTGAGAAAGTTAGTAGTGGCACACAGTATCTCTCACAAGTATCAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	12.10%	0.30%	4.49%	GTC: 0.36%
All Indica	2759	95.10%	1.00%	0.18%	3.48%	GTC: 0.29%
All Japonica	1512	62.00%	35.30%	0.20%	2.18%	GTC: 0.33%
Aus	269	73.60%	0.70%	1.86%	22.30%	GTC: 1.49%
Indica I	595	99.00%	0.70%	0.00%	0.34%	NA
Indica II	465	98.90%	0.40%	0.22%	0.43%	NA
Indica III	913	91.10%	1.40%	0.22%	6.68%	GTC: 0.55%
Indica Intermediate	786	94.40%	1.00%	0.25%	3.94%	GTC: 0.38%
Temperate Japonica	767	78.90%	20.30%	0.13%	0.65%	NA
Tropical Japonica	504	39.90%	54.80%	0.20%	4.37%	GTC: 0.79%
Japonica Intermediate	241	54.40%	42.30%	0.41%	2.49%	GTC: 0.41%
VI/Aromatic	96	79.20%	2.10%	1.04%	17.71%	NA
Intermediate	90	84.40%	8.90%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121977578	G -> T	LOC_Os11g37200.1	upstream_gene_variant ; 4771.0bp to feature; MODIFIER	silent_mutation	Average:58.077; most accessible tissue: Zhenshan97 panicle, score: 94.594	N	N	N	N
vg1121977578	G -> T	LOC_Os11g37190-LOC_Os11g37200	intergenic_region ; MODIFIER	silent_mutation	Average:58.077; most accessible tissue: Zhenshan97 panicle, score: 94.594	N	N	N	N
vg1121977578	G -> DEL	N	N	silent_mutation	Average:58.077; most accessible tissue: Zhenshan97 panicle, score: 94.594	N	N	N	N
vg1121977578	G -> GTC	LOC_Os11g37200.1	upstream_gene_variant ; 4770.0bp to feature; MODIFIER	silent_mutation	Average:58.077; most accessible tissue: Zhenshan97 panicle, score: 94.594	N	N	N	N
vg1121977578	G -> GTC	LOC_Os11g37190-LOC_Os11g37200	intergenic_region ; MODIFIER	silent_mutation	Average:58.077; most accessible tissue: Zhenshan97 panicle, score: 94.594	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1121977578	G	GTC	0.05	-0.06	-0.02	-0.2	-0.21	-0.14
vg1121977578	G	T	-0.07	-0.03	-0.01	-0.05	-0.11	-0.14

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121977578	NA	5.89E-07	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	8.72E-08	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	8.98E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	8.62E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	4.65E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	3.15E-14	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	5.91E-06	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	1.09E-21	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	3.35E-11	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	1.72E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	1.67E-08	4.21E-25	mr1871_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121977578	NA	2.46E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251