\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121955589:

Variant ID: vg1121955589 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21955589
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCTTAGGGATTAGTGCTTCCATCTTCATGACATTCTAATCTCGTTTATATAATTCGCCGAGTTATCATATATCTTATATAATCTCTAGCAATATCGC[T/C]
ATCTAACCCACAATCGGCTAACATCTATTAACAGACGGCAGCCGATTGGGTTAAATGTTGACATTGATCTAGATTATATAAGATATCTACCATTCTATGA

Reverse complement sequence

TCATAGAATGGTAGATATCTTATATAATCTAGATCAATGTCAACATTTAACCCAATCGGCTGCCGTCTGTTAATAGATGTTAGCCGATTGTGGGTTAGAT[A/G]
GCGATATTGCTAGAGATTATATAAGATATATGATAACTCGGCGAATTATATAAACGAGATTAGAATGTCATGAAGATGGAAGCACTAATCCCTAAGAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 22.50% 0.17% 4.99% NA
All Indica  2759 94.20% 1.70% 0.22% 3.88% NA
All Japonica  1512 31.90% 65.40% 0.13% 2.51% NA
Aus  269 71.70% 3.30% 0.00% 24.91% NA
Indica I  595 97.80% 1.70% 0.34% 0.17% NA
Indica II  465 98.10% 1.30% 0.22% 0.43% NA
Indica III  913 91.10% 1.50% 0.11% 7.23% NA
Indica Intermediate  786 92.60% 2.30% 0.25% 4.83% NA
Temperate Japonica  767 18.00% 81.20% 0.13% 0.65% NA
Tropical Japonica  504 58.30% 36.30% 0.00% 5.36% NA
Japonica Intermediate  241 21.20% 75.90% 0.41% 2.49% NA
VI/Aromatic  96 81.20% 0.00% 0.00% 18.75% NA
Intermediate  90 74.40% 18.90% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121955589 T -> DEL N N silent_mutation Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg1121955589 T -> C LOC_Os11g37180.1 upstream_gene_variant ; 928.0bp to feature; MODIFIER silent_mutation Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg1121955589 T -> C LOC_Os11g37170.1 downstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg1121955589 T -> C LOC_Os11g37180-LOC_Os11g37190 intergenic_region ; MODIFIER silent_mutation Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121955589 NA 2.73E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 6.55E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 1.58E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 6.46E-06 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 1.54E-06 NA mr1538 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 1.32E-06 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 3.43E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 4.73E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 2.70E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 4.87E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 1.66E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 3.53E-06 1.71E-22 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 2.66E-10 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 1.87E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 6.42E-14 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 7.16E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 1.36E-35 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 1.97E-08 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 2.40E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 4.58E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 9.49E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 3.95E-16 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 4.44E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 6.32E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 2.29E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 NA 3.85E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589 6.32E-06 NA mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251