Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121955589:

Variant ID: vg1121955589 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21955589
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCTTAGGGATTAGTGCTTCCATCTTCATGACATTCTAATCTCGTTTATATAATTCGCCGAGTTATCATATATCTTATATAATCTCTAGCAATATCGC[T/C]
ATCTAACCCACAATCGGCTAACATCTATTAACAGACGGCAGCCGATTGGGTTAAATGTTGACATTGATCTAGATTATATAAGATATCTACCATTCTATGA

Reverse complement sequence

TCATAGAATGGTAGATATCTTATATAATCTAGATCAATGTCAACATTTAACCCAATCGGCTGCCGTCTGTTAATAGATGTTAGCCGATTGTGGGTTAGAT[A/G]
GCGATATTGCTAGAGATTATATAAGATATATGATAACTCGGCGAATTATATAAACGAGATTAGAATGTCATGAAGATGGAAGCACTAATCCCTAAGAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	22.50%	0.17%	4.99%	NA
All Indica	2759	94.20%	1.70%	0.22%	3.88%	NA
All Japonica	1512	31.90%	65.40%	0.13%	2.51%	NA
Aus	269	71.70%	3.30%	0.00%	24.91%	NA
Indica I	595	97.80%	1.70%	0.34%	0.17%	NA
Indica II	465	98.10%	1.30%	0.22%	0.43%	NA
Indica III	913	91.10%	1.50%	0.11%	7.23%	NA
Indica Intermediate	786	92.60%	2.30%	0.25%	4.83%	NA
Temperate Japonica	767	18.00%	81.20%	0.13%	0.65%	NA
Tropical Japonica	504	58.30%	36.30%	0.00%	5.36%	NA
Japonica Intermediate	241	21.20%	75.90%	0.41%	2.49%	NA
VI/Aromatic	96	81.20%	0.00%	0.00%	18.75%	NA
Intermediate	90	74.40%	18.90%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121955589	T -> DEL	N	N	silent_mutation	Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg1121955589	T -> C	LOC_Os11g37180.1	upstream_gene_variant ; 928.0bp to feature; MODIFIER	silent_mutation	Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg1121955589	T -> C	LOC_Os11g37170.1	downstream_gene_variant ; 4569.0bp to feature; MODIFIER	silent_mutation	Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg1121955589	T -> C	LOC_Os11g37180-LOC_Os11g37190	intergenic_region ; MODIFIER	silent_mutation	Average:21.221; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121955589	NA	2.73E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	6.55E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	1.58E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	6.46E-06	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	1.54E-06	NA	mr1538	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	1.32E-06	mr1538	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	3.43E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	4.73E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	2.70E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	4.87E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	1.66E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	3.53E-06	1.71E-22	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	2.66E-10	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	1.87E-10	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	6.42E-14	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	7.16E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	1.36E-35	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	1.97E-08	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	2.40E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	4.58E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	9.49E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	3.95E-16	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	4.44E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	6.32E-22	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	2.29E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	NA	3.85E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121955589	6.32E-06	NA	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251