\
| Variant ID: vg1121950694 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21950694 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 245. )
GATCAAGCGGAAGATTTCCGATTATCCTCGGCAATGGCATACTCGATTGGCCGAAGCATTCTGGTCTTATAGGATGGCTTGTCATGGATCGATCCAAGTT[C/T]
CTCCTTACAAACTTGTTTATGGACATGAGGCTGTTTTACCATGGGAAGTTAGAATCGGCTCTCGACAAACGGAGTTGCAAAATGATTTGACAGCCGACGA
TCGTCGGCTGTCAAATCATTTTGCAACTCCGTTTGTCGAGAGCCGATTCTAACTTCCCATGGTAAAACAGCCTCATGTCCATAAACAAGTTTGTAAGGAG[G/A]
AACTTGGATCGATCCATGACAAGCCATCCTATAAGACCAGAATGCTTCGGCCAATCGAGTATGCCATTGCCGAGGATAATCGGAAATCTTCCGCTTGATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 6.10% | 2.09% | 1.50% | NA |
| All Indica | 2759 | 91.00% | 6.90% | 1.45% | 0.65% | NA |
| All Japonica | 1512 | 90.80% | 6.30% | 2.05% | 0.79% | NA |
| Aus | 269 | 79.60% | 0.00% | 6.32% | 14.13% | NA |
| Indica I | 595 | 92.80% | 7.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 86.90% | 9.10% | 3.07% | 0.99% | NA |
| Indica Intermediate | 786 | 89.80% | 7.80% | 1.40% | 1.02% | NA |
| Temperate Japonica | 767 | 85.30% | 11.90% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 0.40% | 1.59% | 1.39% | NA |
| Japonica Intermediate | 241 | 96.30% | 1.20% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 8.33% | 2.08% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121950694 | C -> T | LOC_Os11g37170.1 | missense_variant ; p.Pro1558Ser; MODERATE | nonsynonymous_codon ; P1558S | Average:27.14; most accessible tissue: Minghui63 flag leaf, score: 40.473 | benign |
0.814 |
DELETERIOUS | 0.04 |
| vg1121950694 | C -> DEL | LOC_Os11g37170.1 | N | frameshift_variant | Average:27.14; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121950694 | NA | 6.96E-10 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 2.04E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | 3.23E-07 | 3.23E-07 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 7.71E-11 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 8.86E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 2.09E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | 2.49E-06 | 2.49E-06 | mr1804 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | 6.79E-06 | 1.26E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | 9.11E-06 | 1.30E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 9.36E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 1.36E-12 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121950694 | NA | 3.97E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |