\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121947812:

Variant ID: vg1121947812 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21947812
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAGTTAATGTTGCTAATGCCGATTTAGCTCTTTGGGAGATGGATGACCTTGATTGTTTATCTGGAAAAGTCTGGGATGGAGATTTTCTAAAAGTATCC[G/A]
ATTCTGATATACAGCCAATCGAAGATGGAGAACCCAAGCTATTACTTTGAGGGCGTTGTGGAGGGTTCAGATGTTTACGCTAAGGATACAGTAGATGATC

Reverse complement sequence

GATCATCTACTGTATCCTTAGCGTAAACATCTGAACCCTCCACAACGCCCTCAAAGTAATAGCTTGGGTTCTCCATCTTCGATTGGCTGTATATCAGAAT[C/T]
GGATACTTTTAGAAAATCTCCATCCCAGACTTTTCCAGATAAACAATCAAGGTCATCCATCTCCCAAAGAGCTAAATCGGCATTAGCAACATTAACTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 6.90% 1.63% 2.52% NA
All Indica  2759 96.00% 0.70% 1.27% 1.99% NA
All Japonica  1512 83.10% 15.10% 0.86% 0.99% NA
Aus  269 76.60% 0.40% 7.81% 15.24% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 99.10% 0.40% 0.00% 0.43% NA
Indica III  913 92.70% 1.10% 3.07% 3.18% NA
Indica Intermediate  786 95.30% 0.90% 0.89% 2.93% NA
Temperate Japonica  767 92.00% 7.80% 0.00% 0.13% NA
Tropical Japonica  504 66.70% 29.00% 2.18% 2.18% NA
Japonica Intermediate  241 88.80% 9.10% 0.83% 1.24% NA
VI/Aromatic  96 24.00% 65.60% 6.25% 4.17% NA
Intermediate  90 78.90% 14.40% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121947812 G -> A LOC_Os11g37180.1 downstream_gene_variant ; 3808.0bp to feature; MODIFIER silent_mutation Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg1121947812 G -> A LOC_Os11g37170.1 intron_variant ; MODIFIER silent_mutation Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg1121947812 G -> DEL N N silent_mutation Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121947812 NA 4.12E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812 NA 6.90E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812 3.12E-06 5.41E-10 mr1278 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812 NA 1.40E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812 NA 6.34E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812 NA 2.47E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812 NA 8.81E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251