Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121947812:

Variant ID: vg1121947812 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21947812
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCAGTTAATGTTGCTAATGCCGATTTAGCTCTTTGGGAGATGGATGACCTTGATTGTTTATCTGGAAAAGTCTGGGATGGAGATTTTCTAAAAGTATCC[G/A]
ATTCTGATATACAGCCAATCGAAGATGGAGAACCCAAGCTATTACTTTGAGGGCGTTGTGGAGGGTTCAGATGTTTACGCTAAGGATACAGTAGATGATC

Reverse complement sequence

GATCATCTACTGTATCCTTAGCGTAAACATCTGAACCCTCCACAACGCCCTCAAAGTAATAGCTTGGGTTCTCCATCTTCGATTGGCTGTATATCAGAAT[C/T]
GGATACTTTTAGAAAATCTCCATCCCAGACTTTTCCAGATAAACAATCAAGGTCATCCATCTCCCAAAGAGCTAAATCGGCATTAGCAACATTAACTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	6.90%	1.63%	2.52%	NA
All Indica	2759	96.00%	0.70%	1.27%	1.99%	NA
All Japonica	1512	83.10%	15.10%	0.86%	0.99%	NA
Aus	269	76.60%	0.40%	7.81%	15.24%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	99.10%	0.40%	0.00%	0.43%	NA
Indica III	913	92.70%	1.10%	3.07%	3.18%	NA
Indica Intermediate	786	95.30%	0.90%	0.89%	2.93%	NA
Temperate Japonica	767	92.00%	7.80%	0.00%	0.13%	NA
Tropical Japonica	504	66.70%	29.00%	2.18%	2.18%	NA
Japonica Intermediate	241	88.80%	9.10%	0.83%	1.24%	NA
VI/Aromatic	96	24.00%	65.60%	6.25%	4.17%	NA
Intermediate	90	78.90%	14.40%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121947812	G -> A	LOC_Os11g37180.1	downstream_gene_variant ; 3808.0bp to feature; MODIFIER	silent_mutation	Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg1121947812	G -> A	LOC_Os11g37170.1	intron_variant ; MODIFIER	silent_mutation	Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg1121947812	G -> DEL	N	N	silent_mutation	Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121947812	NA	4.12E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812	NA	6.90E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812	3.12E-06	5.41E-10	mr1278	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812	NA	1.40E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812	NA	6.34E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812	NA	2.47E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121947812	NA	8.81E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251