\
| Variant ID: vg1121947812 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21947812 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCAGTTAATGTTGCTAATGCCGATTTAGCTCTTTGGGAGATGGATGACCTTGATTGTTTATCTGGAAAAGTCTGGGATGGAGATTTTCTAAAAGTATCC[G/A]
ATTCTGATATACAGCCAATCGAAGATGGAGAACCCAAGCTATTACTTTGAGGGCGTTGTGGAGGGTTCAGATGTTTACGCTAAGGATACAGTAGATGATC
GATCATCTACTGTATCCTTAGCGTAAACATCTGAACCCTCCACAACGCCCTCAAAGTAATAGCTTGGGTTCTCCATCTTCGATTGGCTGTATATCAGAAT[C/T]
GGATACTTTTAGAAAATCTCCATCCCAGACTTTTCCAGATAAACAATCAAGGTCATCCATCTCCCAAAGAGCTAAATCGGCATTAGCAACATTAACTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 6.90% | 1.63% | 2.52% | NA |
| All Indica | 2759 | 96.00% | 0.70% | 1.27% | 1.99% | NA |
| All Japonica | 1512 | 83.10% | 15.10% | 0.86% | 0.99% | NA |
| Aus | 269 | 76.60% | 0.40% | 7.81% | 15.24% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 92.70% | 1.10% | 3.07% | 3.18% | NA |
| Indica Intermediate | 786 | 95.30% | 0.90% | 0.89% | 2.93% | NA |
| Temperate Japonica | 767 | 92.00% | 7.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 66.70% | 29.00% | 2.18% | 2.18% | NA |
| Japonica Intermediate | 241 | 88.80% | 9.10% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 24.00% | 65.60% | 6.25% | 4.17% | NA |
| Intermediate | 90 | 78.90% | 14.40% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121947812 | G -> A | LOC_Os11g37180.1 | downstream_gene_variant ; 3808.0bp to feature; MODIFIER | silent_mutation | Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg1121947812 | G -> A | LOC_Os11g37170.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg1121947812 | G -> DEL | N | N | silent_mutation | Average:25.905; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121947812 | NA | 4.12E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947812 | NA | 6.90E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947812 | 3.12E-06 | 5.41E-10 | mr1278 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947812 | NA | 1.40E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947812 | NA | 6.34E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947812 | NA | 2.47E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947812 | NA | 8.81E-06 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |