\
| Variant ID: vg1121947567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21947567 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 218. )
AAGACAAATATGGTGCTCAAAGATTTTGGTGGTAATCCATCGGAGACCAAAGGTGTTTTAAATGTGGAGCTGACAGTCGGCAGTAAAACTATTCCTACCA[C/T]
GTTTTTTGTCATTGATGGGAAGGGTTCATACAGTTTGTTGCTTGGAAGATATTGGATTCATGCCAATTGTTGCATCCCTTCAACTATGCATCAGTGCTTG
CAAGCACTGATGCATAGTTGAAGGGATGCAACAATTGGCATGAATCCAATATCTTCCAAGCAACAAACTGTATGAACCCTTCCCATCAATGACAAAAAAC[G/A]
TGGTAGGAATAGTTTTACTGCCGACTGTCAGCTCCACATTTAAAACACCTTTGGTCTCCGATGGATTACCACCAAAATCTTTGAGCACCATATTTGTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 13.60% | 0.95% | 2.62% | NA |
| All Indica | 2759 | 93.80% | 3.10% | 0.47% | 2.57% | NA |
| All Japonica | 1512 | 70.20% | 27.40% | 0.73% | 1.65% | NA |
| Aus | 269 | 70.30% | 16.70% | 5.20% | 7.81% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.00% | 0.34% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 89.40% | 5.50% | 0.77% | 4.38% | NA |
| Indica Intermediate | 786 | 91.90% | 3.90% | 0.64% | 3.56% | NA |
| Temperate Japonica | 767 | 88.40% | 11.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 38.90% | 55.80% | 1.39% | 3.97% | NA |
| Japonica Intermediate | 241 | 77.60% | 19.50% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 14.60% | 75.00% | 6.25% | 4.17% | NA |
| Intermediate | 90 | 67.80% | 27.80% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121947567 | C -> T | LOC_Os11g37170.1 | missense_variant ; p.Thr835Met; MODERATE | nonsynonymous_codon ; T835M | Average:28.984; most accessible tissue: Minghui63 flag leaf, score: 42.036 | benign |
0.903 |
DELETERIOUS | 0.04 |
| vg1121947567 | C -> DEL | LOC_Os11g37170.1 | N | frameshift_variant | Average:28.984; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121947567 | NA | 5.94E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 6.40E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 1.84E-10 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 4.09E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 3.73E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | 4.22E-06 | 1.68E-06 | mr1470 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | 7.85E-06 | 7.83E-06 | mr1481 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 9.00E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 9.55E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 1.50E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 2.63E-08 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | 1.24E-06 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 2.34E-09 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 6.89E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | 6.87E-06 | NA | mr1982 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 1.42E-07 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | NA | 1.17E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121947567 | 5.21E-06 | 5.21E-06 | mr1760_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |