\
| Variant ID: vg1121945630 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21945630 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 232. )
ACAATTCGCTCATCAGTTTGGTCAGTTCGAGCCCATGCAGCAGCAACCACAAGGAGCAGCTCAGCAACGACCATGGGCTGATGTCATTGCTGATGTAATG[A/T]
GGGAGCAATTTGGGCTGAGACCAAAAGAGACTGGGAGTTTGTATCGGCAGCCTTATCCCGAGTGGTTTGAAAGGGTTCCTCTTCCTAATCGGTTTAAAAT
ATTTTAAACCGATTAGGAAGAGGAACCCTTTCAAACCACTCGGGATAAGGCTGCCGATACAAACTCCCAGTCTCTTTTGGTCTCAGCCCAAATTGCTCCC[T/A]
CATTACATCAGCAATGACATCAGCCCATGGTCGTTGCTGAGCTGCTCCTTGTGGTTGCTGCTGCATGGGCTCGAACTGACCAAACTGATGAGCGAATTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 6.70% | 1.63% | 0.25% | NA |
| All Indica | 2759 | 98.60% | 0.70% | 0.62% | 0.07% | NA |
| All Japonica | 1512 | 83.70% | 14.50% | 1.79% | 0.00% | NA |
| Aus | 269 | 85.90% | 0.40% | 10.04% | 3.72% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.00% | 1.20% | 0.55% | 0.22% | NA |
| Indica Intermediate | 786 | 97.70% | 0.90% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 92.20% | 7.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 67.90% | 28.00% | 4.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 8.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 67.70% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121945630 | A -> T | LOC_Os11g37170.1 | missense_variant ; p.Arg267Trp; MODERATE | nonsynonymous_codon ; R267W | Average:44.259; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | probably damaging |
3.422 |
DELETERIOUS | 0.00 |
| vg1121945630 | A -> DEL | LOC_Os11g37170.1 | N | frameshift_variant | Average:44.259; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121945630 | NA | 5.94E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | 3.26E-06 | NA | mr1141 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | NA | 4.58E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | NA | 4.13E-09 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | NA | 1.83E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | 1.72E-06 | 1.71E-06 | mr1481 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | NA | 1.28E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121945630 | NA | 9.13E-06 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |