\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121943688:

Variant ID: vg1121943688 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21943688
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCGTTTATATAATTCGCCGAGTTATCATATATCTTATATAATCTATAGCAATATCGCCATCTAACCCACAATCGGCTAACATATATTAACAGACGGCA[A/G]
CCGATTGGGTTAAATGTTGACATTGATCTAGATTATATAAGATATCTACCATTCTATGAATCTTCTAGTGGCTTGATTGTCTAGATATCATTCTTCTTTT

Reverse complement sequence

AAAAGAAGAATGATATCTAGACAATCAAGCCACTAGAAGATTCATAGAATGGTAGATATCTTATATAATCTAGATCAATGTCAACATTTAACCCAATCGG[T/C]
TGCCGTCTGTTAATATATGTTAGCCGATTGTGGGTTAGATGGCGATATTGCTATAGATTATATAAGATATATGATAACTCGGCGAATTATATAAACGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 22.90% 11.28% 6.81% NA
All Indica  2759 74.70% 2.30% 16.06% 7.00% NA
All Japonica  1512 30.20% 65.70% 1.59% 2.45% NA
Aus  269 51.30% 3.00% 20.45% 25.28% NA
Indica I  595 60.20% 1.80% 33.61% 4.37% NA
Indica II  465 69.50% 1.10% 21.72% 7.74% NA
Indica III  913 85.90% 2.20% 4.05% 7.89% NA
Indica Intermediate  786 75.70% 3.40% 13.36% 7.51% NA
Temperate Japonica  767 15.50% 81.90% 2.35% 0.26% NA
Tropical Japonica  504 57.10% 36.50% 0.79% 5.56% NA
Japonica Intermediate  241 20.70% 75.50% 0.83% 2.90% NA
VI/Aromatic  96 80.20% 0.00% 1.04% 18.75% NA
Intermediate  90 62.20% 20.00% 11.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121943688 A -> DEL N N silent_mutation Average:22.643; most accessible tissue: Callus, score: 39.331 N N N N
vg1121943688 A -> G LOC_Os11g37170.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:22.643; most accessible tissue: Callus, score: 39.331 N N N N
vg1121943688 A -> G LOC_Os11g37160-LOC_Os11g37170 intergenic_region ; MODIFIER silent_mutation Average:22.643; most accessible tissue: Callus, score: 39.331 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121943688 NA 5.79E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.58E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 2.48E-06 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 3.18E-06 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.32E-06 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.13E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 4.80E-06 NA mr1629 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 2.70E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 8.76E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.66E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 5.70E-06 3.28E-22 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 2.12E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 2.12E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 2.30E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.06E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.35E-34 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.97E-08 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.57E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.68E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 4.83E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 9.66E-16 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 4.44E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 1.06E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121943688 NA 7.93E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251