\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121941511:

Variant ID: vg1121941511 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21941511
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCCAATTTAAATTATTCATGAAATGCAATTCCATTTATTAAAAATACTTTCTTGGCTCAAATAAATCCCAGAAAAATCTAGGAACTATAGAATCAAGT[A/C]
AAGTATTTAATAAAATTTTATCTGGCCCAATTTTATATTGGGATTTATTATTTAAAAAAAATAGATCTTCTCGTCTAGGCTTTTAAAATCATTTCTAATA

Reverse complement sequence

TATTAGAAATGATTTTAAAAGCCTAGACGAGAAGATCTATTTTTTTTAAATAATAAATCCCAATATAAAATTGGGCCAGATAAAATTTTATTAAATACTT[T/G]
ACTTGATTCTATAGTTCCTAGATTTTTCTGGGATTTATTTGAGCCAAGAAAGTATTTTTAATAAATGGAATTGCATTTCATGAATAATTTAAATTGGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 5.30% 0.04% 4.80% NA
All Indica  2759 87.20% 8.90% 0.07% 3.81% NA
All Japonica  1512 97.70% 0.10% 0.00% 2.25% NA
Aus  269 75.50% 0.00% 0.00% 24.54% NA
Indica I  595 92.40% 7.20% 0.17% 0.17% NA
Indica II  465 98.50% 1.10% 0.00% 0.43% NA
Indica III  913 78.40% 14.30% 0.00% 7.23% NA
Indica Intermediate  786 86.80% 8.50% 0.13% 4.58% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 94.60% 0.20% 0.00% 5.16% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 82.30% 0.00% 0.00% 17.71% NA
Intermediate  90 88.90% 5.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121941511 A -> DEL N N silent_mutation Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg1121941511 A -> C LOC_Os11g37160.1 upstream_gene_variant ; 4465.0bp to feature; MODIFIER silent_mutation Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg1121941511 A -> C LOC_Os11g37170.1 upstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N
vg1121941511 A -> C LOC_Os11g37160-LOC_Os11g37170 intergenic_region ; MODIFIER silent_mutation Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121941511 NA 2.82E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121941511 NA 5.71E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121941511 NA 9.13E-08 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121941511 NA 9.88E-06 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121941511 NA 2.26E-08 mr1579_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251