\
| Variant ID: vg1121941511 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21941511 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTCCAATTTAAATTATTCATGAAATGCAATTCCATTTATTAAAAATACTTTCTTGGCTCAAATAAATCCCAGAAAAATCTAGGAACTATAGAATCAAGT[A/C]
AAGTATTTAATAAAATTTTATCTGGCCCAATTTTATATTGGGATTTATTATTTAAAAAAAATAGATCTTCTCGTCTAGGCTTTTAAAATCATTTCTAATA
TATTAGAAATGATTTTAAAAGCCTAGACGAGAAGATCTATTTTTTTTAAATAATAAATCCCAATATAAAATTGGGCCAGATAAAATTTTATTAAATACTT[T/G]
ACTTGATTCTATAGTTCCTAGATTTTTCTGGGATTTATTTGAGCCAAGAAAGTATTTTTAATAAATGGAATTGCATTTCATGAATAATTTAAATTGGAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 5.30% | 0.04% | 4.80% | NA |
| All Indica | 2759 | 87.20% | 8.90% | 0.07% | 3.81% | NA |
| All Japonica | 1512 | 97.70% | 0.10% | 0.00% | 2.25% | NA |
| Aus | 269 | 75.50% | 0.00% | 0.00% | 24.54% | NA |
| Indica I | 595 | 92.40% | 7.20% | 0.17% | 0.17% | NA |
| Indica II | 465 | 98.50% | 1.10% | 0.00% | 0.43% | NA |
| Indica III | 913 | 78.40% | 14.30% | 0.00% | 7.23% | NA |
| Indica Intermediate | 786 | 86.80% | 8.50% | 0.13% | 4.58% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 94.60% | 0.20% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 0.00% | 17.71% | NA |
| Intermediate | 90 | 88.90% | 5.60% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121941511 | A -> DEL | N | N | silent_mutation | Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg1121941511 | A -> C | LOC_Os11g37160.1 | upstream_gene_variant ; 4465.0bp to feature; MODIFIER | silent_mutation | Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg1121941511 | A -> C | LOC_Os11g37170.1 | upstream_gene_variant ; 3036.0bp to feature; MODIFIER | silent_mutation | Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg1121941511 | A -> C | LOC_Os11g37160-LOC_Os11g37170 | intergenic_region ; MODIFIER | silent_mutation | Average:31.964; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121941511 | NA | 2.82E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121941511 | NA | 5.71E-06 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121941511 | NA | 9.13E-08 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121941511 | NA | 9.88E-06 | mr1467_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121941511 | NA | 2.26E-08 | mr1579_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |