\
| Variant ID: vg1121939108 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21939108 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACGCAGCAAATATGCAAGTGCACAGGATAACAAAGGATGGCATAGTATAGTCCCATTTGCATAAACAACATTTAATAAATATTTTAGAATTTAATAAAA[C/T]
AGTTAAATGATAATTAAACAATATTAATTCAACGTTATACAACATACCCTGTTGCATAGGCCCAACCATTCTGAACAACCAATCCCGGCTGCACAGTTCT
AGAACTGTGCAGCCGGGATTGGTTGTTCAGAATGGTTGGGCCTATGCAACAGGGTATGTTGTATAACGTTGAATTAATATTGTTTAATTATCATTTAACT[G/A]
TTTTATTAAATTCTAAAATATTTATTAAATGTTGTTTATGCAAATGGGACTATACTATGCCATCCTTTGTTATCCTGTGCACTTGCATATTTGCTGCGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 10.00% | 0.11% | 4.61% | NA |
| All Indica | 2759 | 94.80% | 1.40% | 0.07% | 3.70% | NA |
| All Japonica | 1512 | 70.60% | 27.20% | 0.07% | 2.18% | NA |
| Aus | 269 | 75.80% | 1.10% | 0.74% | 22.30% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 91.10% | 1.60% | 0.11% | 7.12% | NA |
| Indica Intermediate | 786 | 93.00% | 2.50% | 0.13% | 4.33% | NA |
| Temperate Japonica | 767 | 88.50% | 11.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 39.10% | 55.80% | 0.20% | 4.96% | NA |
| Japonica Intermediate | 241 | 79.30% | 17.80% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 75.00% | 7.30% | 0.00% | 17.71% | NA |
| Intermediate | 90 | 78.90% | 14.40% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121939108 | C -> T | LOC_Os11g37160.1 | upstream_gene_variant ; 2062.0bp to feature; MODIFIER | silent_mutation | Average:30.926; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121939108 | C -> T | LOC_Os11g37160-LOC_Os11g37170 | intergenic_region ; MODIFIER | silent_mutation | Average:30.926; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1121939108 | C -> DEL | N | N | silent_mutation | Average:30.926; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121939108 | NA | 1.66E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 2.82E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 7.06E-08 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | 3.05E-06 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 8.96E-09 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 4.58E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 2.94E-07 | mr1982 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 1.87E-06 | mr1991 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 2.21E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 5.01E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 1.64E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 3.01E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | 1.65E-06 | 1.64E-06 | mr1760_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | 2.68E-06 | 2.67E-06 | mr1760_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121939108 | NA | 6.23E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |