\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121844671:

Variant ID: vg1121844671 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 21844671
Reference Allele: CAlternative Allele: T,CTAACTT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCAACACTGGCCCACCACCTGCTGCTGACCTCGCCGCTTCGGCGTCGCCGCCACCCACCGCCTCCCTAGGCCATCCCTCTAAAACCCTAACCCTAACT[C/T,CTAACTT]
GGCGCTTGTCGTGCGTATACACGAATTAGCATTCATGCTTTTTTTTTTCAGCCTGCTTTTGCATGGTTGCGTACCTGTGCATGTGGTGAAGAGGACCTTT

Reverse complement sequence

AAAGGTCCTCTTCACCACATGCACAGGTACGCAACCATGCAAAAGCAGGCTGAAAAAAAAAAGCATGAATGCTAATTCGTGTATACGCACGACAAGCGCC[G/A,AAGTTAG]
AGTTAGGGTTAGGGTTTTAGAGGGATGGCCTAGGGAGGCGGTGGGTGGCGGCGACGCCGAAGCGGCGAGGTCAGCAGCAGGTGGTGGGCCAGTGTTGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 43.40% 0.25% 0.23% CTAACTT: 0.23%
All Indica  2759 60.30% 38.60% 0.29% 0.36% CTAACTT: 0.40%
All Japonica  1512 55.40% 44.40% 0.07% 0.07% NA
Aus  269 32.30% 67.30% 0.37% 0.00% NA
Indica I  595 41.00% 58.50% 0.34% 0.17% NA
Indica II  465 68.20% 28.40% 0.43% 0.65% CTAACTT: 2.37%
Indica III  913 65.30% 34.30% 0.22% 0.22% NA
Indica Intermediate  786 64.60% 34.60% 0.25% 0.51% NA
Temperate Japonica  767 80.20% 19.70% 0.13% 0.00% NA
Tropical Japonica  504 21.80% 78.20% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 52.70% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121844671 C -> CTAACTT LOC_Os11g37000.1 downstream_gene_variant ; 1132.0bp to feature; MODIFIER silent_mutation Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 N N N N
vg1121844671 C -> CTAACTT LOC_Os11g37000-LOC_Os11g37010 intergenic_region ; MODIFIER silent_mutation Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 N N N N
vg1121844671 C -> T LOC_Os11g37000.1 downstream_gene_variant ; 1131.0bp to feature; MODIFIER silent_mutation Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 N N N N
vg1121844671 C -> T LOC_Os11g37000-LOC_Os11g37010 intergenic_region ; MODIFIER silent_mutation Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 N N N N
vg1121844671 C -> DEL N N silent_mutation Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121844671 NA 1.36E-09 mr1502 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 7.99E-09 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 2.52E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 4.80E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 9.33E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 2.02E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 6.52E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671 NA 9.73E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251