Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1121844671:

Variant ID: vg1121844671 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 21844671
Reference Allele: C	Alternative Allele: T,CTAACTT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCAACACTGGCCCACCACCTGCTGCTGACCTCGCCGCTTCGGCGTCGCCGCCACCCACCGCCTCCCTAGGCCATCCCTCTAAAACCCTAACCCTAACT[C/T,CTAACTT]
GGCGCTTGTCGTGCGTATACACGAATTAGCATTCATGCTTTTTTTTTTCAGCCTGCTTTTGCATGGTTGCGTACCTGTGCATGTGGTGAAGAGGACCTTT

Reverse complement sequence

AAAGGTCCTCTTCACCACATGCACAGGTACGCAACCATGCAAAAGCAGGCTGAAAAAAAAAAGCATGAATGCTAATTCGTGTATACGCACGACAAGCGCC[G/A,AAGTTAG]
AGTTAGGGTTAGGGTTTTAGAGGGATGGCCTAGGGAGGCGGTGGGTGGCGGCGACGCCGAAGCGGCGAGGTCAGCAGCAGGTGGTGGGCCAGTGTTGGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.80%	43.40%	0.25%	0.23%	CTAACTT: 0.23%
All Indica	2759	60.30%	38.60%	0.29%	0.36%	CTAACTT: 0.40%
All Japonica	1512	55.40%	44.40%	0.07%	0.07%	NA
Aus	269	32.30%	67.30%	0.37%	0.00%	NA
Indica I	595	41.00%	58.50%	0.34%	0.17%	NA
Indica II	465	68.20%	28.40%	0.43%	0.65%	CTAACTT: 2.37%
Indica III	913	65.30%	34.30%	0.22%	0.22%	NA
Indica Intermediate	786	64.60%	34.60%	0.25%	0.51%	NA
Temperate Japonica	767	80.20%	19.70%	0.13%	0.00%	NA
Tropical Japonica	504	21.80%	78.20%	0.00%	0.00%	NA
Japonica Intermediate	241	46.90%	52.70%	0.00%	0.41%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	47.80%	50.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121844671	C -> CTAACTT	LOC_Os11g37000.1	downstream_gene_variant ; 1132.0bp to feature; MODIFIER	silent_mutation	Average:67.704; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N
vg1121844671	C -> CTAACTT	LOC_Os11g37000-LOC_Os11g37010	intergenic_region ; MODIFIER	silent_mutation	Average:67.704; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N
vg1121844671	C -> T	LOC_Os11g37000.1	downstream_gene_variant ; 1131.0bp to feature; MODIFIER	silent_mutation	Average:67.704; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N
vg1121844671	C -> T	LOC_Os11g37000-LOC_Os11g37010	intergenic_region ; MODIFIER	silent_mutation	Average:67.704; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N
vg1121844671	C -> DEL	N	N	silent_mutation	Average:67.704; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121844671	NA	1.36E-09	mr1502	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	7.99E-09	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	2.52E-07	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	4.80E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	9.33E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	2.02E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	6.52E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121844671	NA	9.73E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251