\
| Variant ID: vg1121844671 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 21844671 |
| Reference Allele: C | Alternative Allele: T,CTAACTT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACCAACACTGGCCCACCACCTGCTGCTGACCTCGCCGCTTCGGCGTCGCCGCCACCCACCGCCTCCCTAGGCCATCCCTCTAAAACCCTAACCCTAACT[C/T,CTAACTT]
GGCGCTTGTCGTGCGTATACACGAATTAGCATTCATGCTTTTTTTTTTCAGCCTGCTTTTGCATGGTTGCGTACCTGTGCATGTGGTGAAGAGGACCTTT
AAAGGTCCTCTTCACCACATGCACAGGTACGCAACCATGCAAAAGCAGGCTGAAAAAAAAAAGCATGAATGCTAATTCGTGTATACGCACGACAAGCGCC[G/A,AAGTTAG]
AGTTAGGGTTAGGGTTTTAGAGGGATGGCCTAGGGAGGCGGTGGGTGGCGGCGACGCCGAAGCGGCGAGGTCAGCAGCAGGTGGTGGGCCAGTGTTGGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 43.40% | 0.25% | 0.23% | CTAACTT: 0.23% |
| All Indica | 2759 | 60.30% | 38.60% | 0.29% | 0.36% | CTAACTT: 0.40% |
| All Japonica | 1512 | 55.40% | 44.40% | 0.07% | 0.07% | NA |
| Aus | 269 | 32.30% | 67.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 41.00% | 58.50% | 0.34% | 0.17% | NA |
| Indica II | 465 | 68.20% | 28.40% | 0.43% | 0.65% | CTAACTT: 2.37% |
| Indica III | 913 | 65.30% | 34.30% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 64.60% | 34.60% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 80.20% | 19.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 21.80% | 78.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.90% | 52.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121844671 | C -> CTAACTT | LOC_Os11g37000.1 | downstream_gene_variant ; 1132.0bp to feature; MODIFIER | silent_mutation | Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 | N | N | N | N |
| vg1121844671 | C -> CTAACTT | LOC_Os11g37000-LOC_Os11g37010 | intergenic_region ; MODIFIER | silent_mutation | Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 | N | N | N | N |
| vg1121844671 | C -> T | LOC_Os11g37000.1 | downstream_gene_variant ; 1131.0bp to feature; MODIFIER | silent_mutation | Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 | N | N | N | N |
| vg1121844671 | C -> T | LOC_Os11g37000-LOC_Os11g37010 | intergenic_region ; MODIFIER | silent_mutation | Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 | N | N | N | N |
| vg1121844671 | C -> DEL | N | N | silent_mutation | Average:67.704; most accessible tissue: Minghui63 root, score: 80.951 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121844671 | NA | 1.36E-09 | mr1502 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 7.99E-09 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 2.52E-07 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 4.80E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 9.33E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 2.02E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 6.52E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121844671 | NA | 9.73E-10 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |