\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121837830:

Variant ID: vg1121837830 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21837830
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGTCTCTAGAATTTGTCCCAAAATATAATAACTTCTACACCAACATTCTCTTCTCAACTAATCAGAACCCTCCACCATTTAATTTTTCTACATACCTC[T/C]
ACATTTCATCCAATCACAACATTTCCCTATTTAATTCTACATACTTTCTTAAGAACCGTGTCCAAACTCTAGAAATGATTATATGTTGGGGCGGAGGGAA

Reverse complement sequence

TTCCCTCCGCCCCAACATATAATCATTTCTAGAGTTTGGACACGGTTCTTAAGAAAGTATGTAGAATTAAATAGGGAAATGTTGTGATTGGATGAAATGT[A/G]
GAGGTATGTAGAAAAATTAAATGGTGGAGGGTTCTGATTAGTTGAGAAGAGAATGTTGGTGTAGAAGTTATTATATTTTGGGACAAATTCTAGAGACTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 32.50% 0.02% 0.32% NA
All Indica  2759 89.60% 9.90% 0.00% 0.54% NA
All Japonica  1512 28.00% 72.00% 0.07% 0.00% NA
Aus  269 50.20% 49.80% 0.00% 0.00% NA
Indica I  595 67.40% 32.60% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 95.00% 3.50% 0.00% 1.53% NA
Indica Intermediate  786 94.90% 5.00% 0.00% 0.13% NA
Temperate Japonica  767 10.30% 89.70% 0.00% 0.00% NA
Tropical Japonica  504 60.10% 39.90% 0.00% 0.00% NA
Japonica Intermediate  241 17.00% 82.60% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121837830 T -> DEL N N silent_mutation Average:45.272; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1121837830 T -> C LOC_Os11g37000.1 upstream_gene_variant ; 1356.0bp to feature; MODIFIER silent_mutation Average:45.272; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1121837830 T -> C LOC_Os11g36990-LOC_Os11g37000 intergenic_region ; MODIFIER silent_mutation Average:45.272; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121837830 NA 1.63E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 1.12E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 8.92E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 1.72E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 1.36E-09 mr1243 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 7.12E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 9.62E-06 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 1.27E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 8.46E-06 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 2.28E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 1.54E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 4.08E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 7.20E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830 NA 1.90E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251