Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1121837830:

Variant ID: vg1121837830 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21837830
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGTCTCTAGAATTTGTCCCAAAATATAATAACTTCTACACCAACATTCTCTTCTCAACTAATCAGAACCCTCCACCATTTAATTTTTCTACATACCTC[T/C]
ACATTTCATCCAATCACAACATTTCCCTATTTAATTCTACATACTTTCTTAAGAACCGTGTCCAAACTCTAGAAATGATTATATGTTGGGGCGGAGGGAA

Reverse complement sequence

TTCCCTCCGCCCCAACATATAATCATTTCTAGAGTTTGGACACGGTTCTTAAGAAAGTATGTAGAATTAAATAGGGAAATGTTGTGATTGGATGAAATGT[A/G]
GAGGTATGTAGAAAAATTAAATGGTGGAGGGTTCTGATTAGTTGAGAAGAGAATGTTGGTGTAGAAGTTATTATATTTTGGGACAAATTCTAGAGACTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	32.50%	0.02%	0.32%	NA
All Indica	2759	89.60%	9.90%	0.00%	0.54%	NA
All Japonica	1512	28.00%	72.00%	0.07%	0.00%	NA
Aus	269	50.20%	49.80%	0.00%	0.00%	NA
Indica I	595	67.40%	32.60%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	95.00%	3.50%	0.00%	1.53%	NA
Indica Intermediate	786	94.90%	5.00%	0.00%	0.13%	NA
Temperate Japonica	767	10.30%	89.70%	0.00%	0.00%	NA
Tropical Japonica	504	60.10%	39.90%	0.00%	0.00%	NA
Japonica Intermediate	241	17.00%	82.60%	0.41%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121837830	T -> DEL	N	N	silent_mutation	Average:45.272; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg1121837830	T -> C	LOC_Os11g37000.1	upstream_gene_variant ; 1356.0bp to feature; MODIFIER	silent_mutation	Average:45.272; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg1121837830	T -> C	LOC_Os11g36990-LOC_Os11g37000	intergenic_region ; MODIFIER	silent_mutation	Average:45.272; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121837830	NA	1.63E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	1.12E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	8.92E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	1.72E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	1.36E-09	mr1243	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	7.12E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	9.62E-06	mr1517	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	1.27E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	8.46E-06	mr1538	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	2.28E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	1.54E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	4.08E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	7.20E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121837830	NA	1.90E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251