Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1121822027:

Variant ID: vg1121822027 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21822027
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

CCGAAAATACACCTTTTTATTTTTCTGTGTCGACTCCAATACCATTGACTTGGAACACATCCTACTTGCTAGGTTTGGCAGAGAATGATAAATGGAATGA[C/T]
TCATAAATTACTAATAACCCAGAACATATCAAGATAATTAGTGATTTTTTTATTAAGATTGTTTCCAAGCTACACTACTACATGTATGCGATGTTGGTAT

Reverse complement sequence

ATACCAACATCGCATACATGTAGTAGTGTAGCTTGGAAACAATCTTAATAAAAAAATCACTAATTATCTTGATATGTTCTGGGTTATTAGTAATTTATGA[G/A]
TCATTCCATTTATCATTCTCTGCCAAACCTAGCAAGTAGGATGTGTTCCAAGTCAATGGTATTGGAGTCGACACAGAAAAATAAAAAGGTGTATTTTCGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	25.80%	0.25%	16.86%	NA
All Indica	2759	82.90%	2.40%	0.33%	14.39%	NA
All Japonica	1512	10.50%	71.20%	0.07%	18.19%	NA
Aus	269	43.50%	13.40%	0.37%	42.75%	NA
Indica I	595	67.90%	1.80%	0.84%	29.41%	NA
Indica II	465	97.60%	1.50%	0.22%	0.65%	NA
Indica III	913	79.30%	2.80%	0.22%	17.63%	NA
Indica Intermediate	786	89.60%	2.90%	0.13%	7.38%	NA
Temperate Japonica	767	7.30%	88.30%	0.00%	4.43%	NA
Tropical Japonica	504	17.10%	39.90%	0.20%	42.86%	NA
Japonica Intermediate	241	7.10%	82.60%	0.00%	10.37%	NA
VI/Aromatic	96	81.20%	16.70%	1.04%	1.04%	NA
Intermediate	90	65.60%	24.40%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121822027	C -> T	LOC_Os11g36980.1	downstream_gene_variant ; 2702.0bp to feature; MODIFIER	silent_mutation	Average:29.427; most accessible tissue: Callus, score: 63.611	N	N	N	N
vg1121822027	C -> T	LOC_Os11g36970.1	intron_variant ; MODIFIER	silent_mutation	Average:29.427; most accessible tissue: Callus, score: 63.611	N	N	N	N
vg1121822027	C -> DEL	N	N	silent_mutation	Average:29.427; most accessible tissue: Callus, score: 63.611	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121822027	NA	1.77E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	5.26E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	5.64E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	5.02E-09	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	9.53E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	2.74E-09	mr1629	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	1.55E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	3.13E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027	NA	5.74E-08	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251