\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121822027:

Variant ID: vg1121822027 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21822027
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAAAATACACCTTTTTATTTTTCTGTGTCGACTCCAATACCATTGACTTGGAACACATCCTACTTGCTAGGTTTGGCAGAGAATGATAAATGGAATGA[C/T]
TCATAAATTACTAATAACCCAGAACATATCAAGATAATTAGTGATTTTTTTATTAAGATTGTTTCCAAGCTACACTACTACATGTATGCGATGTTGGTAT

Reverse complement sequence

ATACCAACATCGCATACATGTAGTAGTGTAGCTTGGAAACAATCTTAATAAAAAAATCACTAATTATCTTGATATGTTCTGGGTTATTAGTAATTTATGA[G/A]
TCATTCCATTTATCATTCTCTGCCAAACCTAGCAAGTAGGATGTGTTCCAAGTCAATGGTATTGGAGTCGACACAGAAAAATAAAAAGGTGTATTTTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 25.80% 0.25% 16.86% NA
All Indica  2759 82.90% 2.40% 0.33% 14.39% NA
All Japonica  1512 10.50% 71.20% 0.07% 18.19% NA
Aus  269 43.50% 13.40% 0.37% 42.75% NA
Indica I  595 67.90% 1.80% 0.84% 29.41% NA
Indica II  465 97.60% 1.50% 0.22% 0.65% NA
Indica III  913 79.30% 2.80% 0.22% 17.63% NA
Indica Intermediate  786 89.60% 2.90% 0.13% 7.38% NA
Temperate Japonica  767 7.30% 88.30% 0.00% 4.43% NA
Tropical Japonica  504 17.10% 39.90% 0.20% 42.86% NA
Japonica Intermediate  241 7.10% 82.60% 0.00% 10.37% NA
VI/Aromatic  96 81.20% 16.70% 1.04% 1.04% NA
Intermediate  90 65.60% 24.40% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121822027 C -> T LOC_Os11g36980.1 downstream_gene_variant ; 2702.0bp to feature; MODIFIER silent_mutation Average:29.427; most accessible tissue: Callus, score: 63.611 N N N N
vg1121822027 C -> T LOC_Os11g36970.1 intron_variant ; MODIFIER silent_mutation Average:29.427; most accessible tissue: Callus, score: 63.611 N N N N
vg1121822027 C -> DEL N N silent_mutation Average:29.427; most accessible tissue: Callus, score: 63.611 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121822027 NA 1.77E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 5.26E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 5.64E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 5.02E-09 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 9.53E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 2.74E-09 mr1629 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 1.55E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 3.13E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121822027 NA 5.74E-08 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251