RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1121803238:

Variant ID: vg1121803238 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21803238
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TTATCAGGGTGCTAGCCGATAAGTTAATGCTAGTGTTTTATCGGGGTGCTAGCCGATAAGTTATCTGGACATTGCATCGGCTTACAAAGATTACATACAA[A/G]
TTGGATTTAGCCGATTGCAACAAAGGTTTCACTGTTTATCTAAATTGATTGGATTTTATGACATCGGAATTTTAGCCGATGTATGCTTTAACCATCGAAT

Reverse complement sequence

ATTCGATGGTTAAAGCATACATCGGCTAAAATTCCGATGTCATAAAATCCAATCAATTTAGATAAACAGTGAAACCTTTGTTGCAATCGGCTAAATCCAA[T/C]
TTGTATGTAATCTTTGTAAGCCGATGCAATGTCCAGATAACTTATCGGCTAGCACCCCGATAAAACACTAGCATTAACTTATCGGCTAGCACCCTGATAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	24.90%	2.18%	3.60%	NA
All Indica	2759	64.90%	26.60%	3.01%	5.44%	NA
All Japonica	1512	78.30%	19.40%	1.12%	1.19%	NA
Aus	269	79.60%	20.40%	0.00%	0.00%	NA
Indica I	595	73.80%	22.00%	2.35%	1.85%	NA
Indica II	465	60.60%	29.50%	4.95%	4.95%	NA
Indica III	913	62.70%	28.00%	1.64%	7.67%	NA
Indica Intermediate	786	63.40%	26.80%	3.94%	5.85%	NA
Temperate Japonica	767	94.30%	3.90%	1.04%	0.78%	NA
Tropical Japonica	504	51.80%	46.00%	0.79%	1.39%	NA
Japonica Intermediate	241	83.00%	12.90%	2.07%	2.07%	NA
VI/Aromatic	96	27.10%	69.80%	2.08%	1.04%	NA
Intermediate	90	70.00%	27.80%	1.11%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121803238	A -> DEL	N	N	silent_mutation	Average:21.101; most accessible tissue: Callus, score: 34.153	N	N	N	N
vg1121803238	A -> G	LOC_Os11g36960.1	upstream_gene_variant ; 2861.0bp to feature; MODIFIER	silent_mutation	Average:21.101; most accessible tissue: Callus, score: 34.153	N	N	N	N
vg1121803238	A -> G	LOC_Os11g36950.1	downstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:21.101; most accessible tissue: Callus, score: 34.153	N	N	N	N
vg1121803238	A -> G	LOC_Os11g36950-LOC_Os11g36960	intergenic_region ; MODIFIER	silent_mutation	Average:21.101; most accessible tissue: Callus, score: 34.153	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121803238	NA	1.16E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121803238	NA	1.60E-10	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121803238	7.00E-07	6.44E-13	mr1980	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121803238	NA	8.85E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121803238	NA	1.48E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1121803238:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact