\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121741517:

Variant ID: vg1121741517 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21741517
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTATGACAGCGAGACAAGGCATCTGCGGCCTTATTTTCAAGACCCTTTTTATACACCAACTTGTATTGCAAACCAAGAAGTTTAGTGAGAGCTCGTTG[C/T]
TGCCAAGGGGTAACCAGCCTCTGATCGTCTAAGTGAATCAAACTCCTCTGATTGGTGCGAATGATAAACTCTCCGAATTGCAAGTACGATCACCAATGGT

Reverse complement sequence

ACCATTGGTGATCGTACTTGCAATTCGGAGAGTTTATCATTCGCACCAATCAGAGGAGTTTGATTCACTTAGACGATCAGAGGCTGGTTACCCCTTGGCA[G/A]
CAACGAGCTCTCACTAAACTTCTTGGTTTGCAATACAAGTTGGTGTATAAAAAGGGTCTTGAAAATAAGGCCGCAGATGCCTTGTCTCGCTGTCATACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 3.00% 1.02% 2.20% NA
All Indica  2759 99.80% 0.00% 0.11% 0.07% NA
All Japonica  1512 83.30% 9.30% 2.98% 4.50% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 75.10% 17.60% 4.30% 3.00% NA
Tropical Japonica  504 95.80% 0.00% 0.99% 3.17% NA
Japonica Intermediate  241 83.00% 2.10% 2.90% 12.03% NA
VI/Aromatic  96 69.80% 0.00% 0.00% 30.21% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121741517 C -> T LOC_Os11g36850.1 upstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1121741517 C -> T LOC_Os11g36870.1 upstream_gene_variant ; 4533.0bp to feature; MODIFIER silent_mutation Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1121741517 C -> T LOC_Os11g36860.1 downstream_gene_variant ; 90.0bp to feature; MODIFIER silent_mutation Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1121741517 C -> T LOC_Os11g36850-LOC_Os11g36860 intergenic_region ; MODIFIER silent_mutation Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N
vg1121741517 C -> DEL N N silent_mutation Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121741517 NA 9.29E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 2.31E-07 2.31E-07 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 1.24E-06 8.66E-12 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 2.99E-07 1.53E-12 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 1.72E-06 1.80E-08 mr1379 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 1.08E-09 1.08E-09 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 8.38E-06 2.93E-09 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 1.68E-06 5.24E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 1.78E-06 2.14E-13 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 1.31E-07 5.18E-13 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 2.83E-06 2.83E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 3.73E-06 3.73E-06 mr1703 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 4.28E-06 2.72E-10 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 NA 1.89E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 4.95E-06 1.66E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 NA 5.64E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 NA 8.81E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517 NA 7.31E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251