Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121741517:

Variant ID: vg1121741517 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21741517
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTATGACAGCGAGACAAGGCATCTGCGGCCTTATTTTCAAGACCCTTTTTATACACCAACTTGTATTGCAAACCAAGAAGTTTAGTGAGAGCTCGTTG[C/T]
TGCCAAGGGGTAACCAGCCTCTGATCGTCTAAGTGAATCAAACTCCTCTGATTGGTGCGAATGATAAACTCTCCGAATTGCAAGTACGATCACCAATGGT

Reverse complement sequence

ACCATTGGTGATCGTACTTGCAATTCGGAGAGTTTATCATTCGCACCAATCAGAGGAGTTTGATTCACTTAGACGATCAGAGGCTGGTTACCCCTTGGCA[G/A]
CAACGAGCTCTCACTAAACTTCTTGGTTTGCAATACAAGTTGGTGTATAAAAAGGGTCTTGAAAATAAGGCCGCAGATGCCTTGTCTCGCTGTCATACTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	3.00%	1.02%	2.20%	NA
All Indica	2759	99.80%	0.00%	0.11%	0.07%	NA
All Japonica	1512	83.30%	9.30%	2.98%	4.50%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.00%	0.11%	0.11%	NA
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	75.10%	17.60%	4.30%	3.00%	NA
Tropical Japonica	504	95.80%	0.00%	0.99%	3.17%	NA
Japonica Intermediate	241	83.00%	2.10%	2.90%	12.03%	NA
VI/Aromatic	96	69.80%	0.00%	0.00%	30.21%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121741517	C -> T	LOC_Os11g36850.1	upstream_gene_variant ; 418.0bp to feature; MODIFIER	silent_mutation	Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053	N	N	N	N
vg1121741517	C -> T	LOC_Os11g36870.1	upstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053	N	N	N	N
vg1121741517	C -> T	LOC_Os11g36860.1	downstream_gene_variant ; 90.0bp to feature; MODIFIER	silent_mutation	Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053	N	N	N	N
vg1121741517	C -> T	LOC_Os11g36850-LOC_Os11g36860	intergenic_region ; MODIFIER	silent_mutation	Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053	N	N	N	N
vg1121741517	C -> DEL	N	N	silent_mutation	Average:59.639; most accessible tissue: Minghui63 flag leaf, score: 82.053	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121741517	NA	9.29E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	2.31E-07	2.31E-07	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	1.24E-06	8.66E-12	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	2.99E-07	1.53E-12	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	1.72E-06	1.80E-08	mr1379	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	1.08E-09	1.08E-09	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	8.38E-06	2.93E-09	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	1.68E-06	5.24E-06	mr1559	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	1.78E-06	2.14E-13	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	1.31E-07	5.18E-13	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	2.83E-06	2.83E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	3.73E-06	3.73E-06	mr1703	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	4.28E-06	2.72E-10	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	NA	1.89E-06	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	4.95E-06	1.66E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	NA	5.64E-12	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	NA	8.81E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121741517	NA	7.31E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251