\
| Variant ID: vg1121730637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21730637 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAACACATTGGTGTCCACTAAGGTCCTGTTTGGTTCCATGGGCTAATGTTTAGCCCTCACCTTTTAGCCTCAAATTAGCCCTCAAGGATCCAAACAGGT[G/A]
GGCTAATTTTGAGCTAATATGAATTAGCTCCCCACAAAACATTAGCCCCTCTAAGGGGTGCTAATGAGGCTAATTTTGTGTGGGGACCATCAAAAAGCAG
CTGCTTTTTGATGGTCCCCACACAAAATTAGCCTCATTAGCACCCCTTAGAGGGGCTAATGTTTTGTGGGGAGCTAATTCATATTAGCTCAAAATTAGCC[C/T]
ACCTGTTTGGATCCTTGAGGGCTAATTTGAGGCTAAAAGGTGAGGGCTAAACATTAGCCCATGGAACCAAACAGGACCTTAGTGGACACCAATGTGTTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 29.30% | 0.66% | 11.87% | NA |
| All Indica | 2759 | 64.70% | 18.00% | 1.01% | 16.24% | NA |
| All Japonica | 1512 | 55.80% | 42.80% | 0.07% | 1.39% | NA |
| Aus | 269 | 14.90% | 73.60% | 0.37% | 11.15% | NA |
| Indica I | 595 | 27.40% | 52.40% | 1.68% | 18.49% | NA |
| Indica II | 465 | 72.70% | 3.20% | 1.29% | 22.80% | NA |
| Indica III | 913 | 82.40% | 6.00% | 0.11% | 11.50% | NA |
| Indica Intermediate | 786 | 67.80% | 14.60% | 1.40% | 16.16% | NA |
| Temperate Japonica | 767 | 78.40% | 21.00% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 26.60% | 71.00% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 44.80% | 53.10% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 37.50% | 8.30% | 1.04% | 53.12% | NA |
| Intermediate | 90 | 50.00% | 37.80% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121730637 | G -> A | LOC_Os11g36810.1 | upstream_gene_variant ; 1428.0bp to feature; MODIFIER | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1121730637 | G -> A | LOC_Os11g36800.1 | downstream_gene_variant ; 2997.0bp to feature; MODIFIER | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1121730637 | G -> A | LOC_Os11g36820.1 | downstream_gene_variant ; 54.0bp to feature; MODIFIER | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1121730637 | G -> A | LOC_Os11g36830.1 | downstream_gene_variant ; 175.0bp to feature; MODIFIER | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1121730637 | G -> A | LOC_Os11g36840.1 | downstream_gene_variant ; 3540.0bp to feature; MODIFIER | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1121730637 | G -> A | LOC_Os11g36820-LOC_Os11g36830 | intergenic_region ; MODIFIER | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1121730637 | G -> DEL | N | N | silent_mutation | Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121730637 | NA | 5.30E-17 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1121730637 | NA | 1.91E-08 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.77E-08 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.13E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 8.82E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 4.20E-07 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.36E-08 | mr1167_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 9.43E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.31E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.22E-07 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.29E-09 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121730637 | NA | 1.35E-08 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |