\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121730637:

Variant ID: vg1121730637 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21730637
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAACACATTGGTGTCCACTAAGGTCCTGTTTGGTTCCATGGGCTAATGTTTAGCCCTCACCTTTTAGCCTCAAATTAGCCCTCAAGGATCCAAACAGGT[G/A]
GGCTAATTTTGAGCTAATATGAATTAGCTCCCCACAAAACATTAGCCCCTCTAAGGGGTGCTAATGAGGCTAATTTTGTGTGGGGACCATCAAAAAGCAG

Reverse complement sequence

CTGCTTTTTGATGGTCCCCACACAAAATTAGCCTCATTAGCACCCCTTAGAGGGGCTAATGTTTTGTGGGGAGCTAATTCATATTAGCTCAAAATTAGCC[C/T]
ACCTGTTTGGATCCTTGAGGGCTAATTTGAGGCTAAAAGGTGAGGGCTAAACATTAGCCCATGGAACCAAACAGGACCTTAGTGGACACCAATGTGTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 29.30% 0.66% 11.87% NA
All Indica  2759 64.70% 18.00% 1.01% 16.24% NA
All Japonica  1512 55.80% 42.80% 0.07% 1.39% NA
Aus  269 14.90% 73.60% 0.37% 11.15% NA
Indica I  595 27.40% 52.40% 1.68% 18.49% NA
Indica II  465 72.70% 3.20% 1.29% 22.80% NA
Indica III  913 82.40% 6.00% 0.11% 11.50% NA
Indica Intermediate  786 67.80% 14.60% 1.40% 16.16% NA
Temperate Japonica  767 78.40% 21.00% 0.13% 0.52% NA
Tropical Japonica  504 26.60% 71.00% 0.00% 2.38% NA
Japonica Intermediate  241 44.80% 53.10% 0.00% 2.07% NA
VI/Aromatic  96 37.50% 8.30% 1.04% 53.12% NA
Intermediate  90 50.00% 37.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121730637 G -> A LOC_Os11g36810.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1121730637 G -> A LOC_Os11g36800.1 downstream_gene_variant ; 2997.0bp to feature; MODIFIER silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1121730637 G -> A LOC_Os11g36820.1 downstream_gene_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1121730637 G -> A LOC_Os11g36830.1 downstream_gene_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1121730637 G -> A LOC_Os11g36840.1 downstream_gene_variant ; 3540.0bp to feature; MODIFIER silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1121730637 G -> A LOC_Os11g36820-LOC_Os11g36830 intergenic_region ; MODIFIER silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1121730637 G -> DEL N N silent_mutation Average:45.816; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121730637 NA 5.30E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1121730637 NA 1.91E-08 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.77E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.13E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 8.82E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 4.20E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.36E-08 mr1167_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 9.43E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.31E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.22E-07 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.29E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121730637 NA 1.35E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251