Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1121714352:

Variant ID: vg1121714352 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21714352
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTACACTTCAAGATATATTTTAGCAATATAAACTTGAATAGAAATTTTTCTTTGTGCATAATCTTCAATTGGAAAGTATATTTCTTTTTGGAAAAAGTA[C/T]
GAATTACCCCCTGAACTATCACGGTCGTCCAAATTCCCCCCCTAAACCCGAAAACCATACATTATTCACCCTAAACTTTCAATACCGGACGAATTACCCC

Reverse complement sequence

GGGGTAATTCGTCCGGTATTGAAAGTTTAGGGTGAATAATGTATGGTTTTCGGGTTTAGGGGGGGAATTTGGACGACCGTGATAGTTCAGGGGGTAATTC[G/A]
TACTTTTTCCAAAAAGAAATATACTTTCCAATTGAAGATTATGCACAAAGAAAAATTTCTATTCAAGTTTATATTGCTAAAATATATCTTGAAGTGTAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	3.10%	0.85%	12.48%	NA
All Indica	2759	82.40%	0.00%	0.51%	17.07%	NA
All Japonica	1512	87.20%	9.70%	1.72%	1.39%	NA
Aus	269	88.50%	0.00%	0.00%	11.52%	NA
Indica I	595	80.20%	0.00%	0.67%	19.16%	NA
Indica II	465	74.80%	0.00%	0.86%	24.30%	NA
Indica III	913	88.00%	0.00%	0.11%	11.94%	NA
Indica Intermediate	786	82.20%	0.00%	0.64%	17.18%	NA
Temperate Japonica	767	78.20%	18.00%	3.13%	0.65%	NA
Tropical Japonica	504	97.20%	0.40%	0.20%	2.18%	NA
Japonica Intermediate	241	95.00%	2.50%	0.41%	2.07%	NA
VI/Aromatic	96	41.70%	0.00%	0.00%	58.33%	NA
Intermediate	90	87.80%	0.00%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121714352	C -> T	LOC_Os11g36780.1	upstream_gene_variant ; 2490.0bp to feature; MODIFIER	silent_mutation	Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg1121714352	C -> T	LOC_Os11g36790.1	upstream_gene_variant ; 4978.0bp to feature; MODIFIER	silent_mutation	Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg1121714352	C -> T	LOC_Os11g36770.1	downstream_gene_variant ; 2217.0bp to feature; MODIFIER	silent_mutation	Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg1121714352	C -> T	LOC_Os11g36770-LOC_Os11g36780	intergenic_region ; MODIFIER	silent_mutation	Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg1121714352	C -> DEL	N	N	silent_mutation	Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1121714352	C	T	0.03	0.01	0.01	0.01	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121714352	NA	2.29E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	2.05E-07	2.05E-07	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	3.49E-06	2.79E-11	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	9.31E-07	8.37E-12	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	9.70E-06	1.20E-07	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	1.01E-10	1.01E-10	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	NA	1.35E-08	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	9.65E-06	2.32E-12	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	7.56E-07	2.47E-12	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	6.52E-06	6.52E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	2.06E-07	1.06E-11	mr1765	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	NA	3.78E-06	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	NA	3.68E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	NA	1.13E-11	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352	NA	3.90E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251