\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121714352:

Variant ID: vg1121714352 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21714352
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTACACTTCAAGATATATTTTAGCAATATAAACTTGAATAGAAATTTTTCTTTGTGCATAATCTTCAATTGGAAAGTATATTTCTTTTTGGAAAAAGTA[C/T]
GAATTACCCCCTGAACTATCACGGTCGTCCAAATTCCCCCCCTAAACCCGAAAACCATACATTATTCACCCTAAACTTTCAATACCGGACGAATTACCCC

Reverse complement sequence

GGGGTAATTCGTCCGGTATTGAAAGTTTAGGGTGAATAATGTATGGTTTTCGGGTTTAGGGGGGGAATTTGGACGACCGTGATAGTTCAGGGGGTAATTC[G/A]
TACTTTTTCCAAAAAGAAATATACTTTCCAATTGAAGATTATGCACAAAGAAAAATTTCTATTCAAGTTTATATTGCTAAAATATATCTTGAAGTGTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 3.10% 0.85% 12.48% NA
All Indica  2759 82.40% 0.00% 0.51% 17.07% NA
All Japonica  1512 87.20% 9.70% 1.72% 1.39% NA
Aus  269 88.50% 0.00% 0.00% 11.52% NA
Indica I  595 80.20% 0.00% 0.67% 19.16% NA
Indica II  465 74.80% 0.00% 0.86% 24.30% NA
Indica III  913 88.00% 0.00% 0.11% 11.94% NA
Indica Intermediate  786 82.20% 0.00% 0.64% 17.18% NA
Temperate Japonica  767 78.20% 18.00% 3.13% 0.65% NA
Tropical Japonica  504 97.20% 0.40% 0.20% 2.18% NA
Japonica Intermediate  241 95.00% 2.50% 0.41% 2.07% NA
VI/Aromatic  96 41.70% 0.00% 0.00% 58.33% NA
Intermediate  90 87.80% 0.00% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121714352 C -> T LOC_Os11g36780.1 upstream_gene_variant ; 2490.0bp to feature; MODIFIER silent_mutation Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg1121714352 C -> T LOC_Os11g36790.1 upstream_gene_variant ; 4978.0bp to feature; MODIFIER silent_mutation Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg1121714352 C -> T LOC_Os11g36770.1 downstream_gene_variant ; 2217.0bp to feature; MODIFIER silent_mutation Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg1121714352 C -> T LOC_Os11g36770-LOC_Os11g36780 intergenic_region ; MODIFIER silent_mutation Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg1121714352 C -> DEL N N silent_mutation Average:42.352; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121714352 C T 0.03 0.01 0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121714352 NA 2.29E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 2.05E-07 2.05E-07 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 3.49E-06 2.79E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 9.31E-07 8.37E-12 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 9.70E-06 1.20E-07 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 1.01E-10 1.01E-10 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 NA 1.35E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 9.65E-06 2.32E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 7.56E-07 2.47E-12 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 6.52E-06 6.52E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 2.06E-07 1.06E-11 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 NA 3.78E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 NA 3.68E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 NA 1.13E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121714352 NA 3.90E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251