RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1121711093:

Variant ID: vg1121711093 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21711093
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAAACTCAGGGTGAAAAATAATTAGATTTAGGGCTTTGGGCGTGAGATTTTGCACGGCTCTCGTAGAAACTCCTATAAAACTAGAAAACATCGCGCAC[G/A]
CACGTTGGTGTGGGTTTGATTGTCCTGTCATTGTCATTTAATATTATCGTTTAAAAATATGTACCTTTTTTACTTTGGTATTTATTTTGGAACTAATGTA

Reverse complement sequence

TACATTAGTTCCAAAATAAATACCAAAGTAAAAAAGGTACATATTTTTAAACGATAATATTAAATGACAATGACAGGACAATCAAACCCACACCAACGTG[C/T]
GTGCGCGATGTTTTCTAGTTTTATAGGAGTTTCTACGAGAGCCGTGCAAAATCTCACGCCCAAAGCCCTAAATCTAATTATTTTTCACCCTGAGTTTTCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	2.70%	1.25%	0.00%	NA
All Indica	2759	99.80%	0.00%	0.18%	0.00%	NA
All Japonica	1512	88.10%	8.40%	3.51%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.38%	0.00%	NA
Temperate Japonica	767	78.20%	15.30%	6.52%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	2.90%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121711093	G -> A	LOC_Os11g36770.1	upstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg1121711093	G -> A	LOC_Os11g36760.1	downstream_gene_variant ; 3064.0bp to feature; MODIFIER	silent_mutation	Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg1121711093	G -> A	LOC_Os11g36760-LOC_Os11g36770	intergenic_region ; MODIFIER	silent_mutation	Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121711093	NA	3.11E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	2.33E-08	2.33E-08	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	1.25E-06	5.76E-12	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	5.47E-07	2.37E-12	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	1.75E-06	2.00E-08	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	3.05E-10	3.05E-10	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	8.66E-06	1.63E-09	mr1515	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	3.24E-06	9.41E-06	mr1559	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	2.28E-06	1.77E-13	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121711093	3.96E-07	9.41E-13	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1121711093:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact