Variant ID: vg1121711093 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 21711093 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAAAACTCAGGGTGAAAAATAATTAGATTTAGGGCTTTGGGCGTGAGATTTTGCACGGCTCTCGTAGAAACTCCTATAAAACTAGAAAACATCGCGCAC[G/A]
CACGTTGGTGTGGGTTTGATTGTCCTGTCATTGTCATTTAATATTATCGTTTAAAAATATGTACCTTTTTTACTTTGGTATTTATTTTGGAACTAATGTA
TACATTAGTTCCAAAATAAATACCAAAGTAAAAAAGGTACATATTTTTAAACGATAATATTAAATGACAATGACAGGACAATCAAACCCACACCAACGTG[C/T]
GTGCGCGATGTTTTCTAGTTTTATAGGAGTTTCTACGAGAGCCGTGCAAAATCTCACGCCCAAAGCCCTAAATCTAATTATTTTTCACCCTGAGTTTTCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.10% | 2.70% | 1.25% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.00% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 88.10% | 8.40% | 3.51% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 78.20% | 15.30% | 6.52% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 95.90% | 2.90% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1121711093 | G -> A | LOC_Os11g36770.1 | upstream_gene_variant ; 336.0bp to feature; MODIFIER | silent_mutation | Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
vg1121711093 | G -> A | LOC_Os11g36760.1 | downstream_gene_variant ; 3064.0bp to feature; MODIFIER | silent_mutation | Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
vg1121711093 | G -> A | LOC_Os11g36760-LOC_Os11g36770 | intergenic_region ; MODIFIER | silent_mutation | Average:46.862; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1121711093 | NA | 3.11E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 2.33E-08 | 2.33E-08 | mr1166 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 1.25E-06 | 5.76E-12 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 5.47E-07 | 2.37E-12 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 1.75E-06 | 2.00E-08 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 3.05E-10 | 3.05E-10 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 8.66E-06 | 1.63E-09 | mr1515 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 3.24E-06 | 9.41E-06 | mr1559 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 2.28E-06 | 1.77E-13 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1121711093 | 3.96E-07 | 9.41E-13 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/