\
| Variant ID: vg1121697590 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21697590 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTAAAACTTTTATTTTGGTCATTTCTTCATACGACAAAGTGATAGTAACATTATTCATAAAATTGACATATCTCTTATCTGGTTTTATAAACTATAACA[C/A]
ATATATGTAAAATTTATGAATAATATTACTAACATTTCGTTGGATGAAGAAATAACAAAAATAAAAGTTTTAGATCTTGATGAATTATTCAACTTTGTTG
CAACAAAGTTGAATAATTCATCAAGATCTAAAACTTTTATTTTTGTTATTTCTTCATCCAACGAAATGTTAGTAATATTATTCATAAATTTTACATATAT[G/T]
TGTTATAGTTTATAAAACCAGATAAGAGATATGTCAATTTTATGAATAATGTTACTATCACTTTGTCGTATGAAGAAATGACCAAAATAAAAGTTTTAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 4.70% | 2.48% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 4.30% | 2.86% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.20% | 0.53% | 0.00% | NA |
| Aus | 269 | 59.50% | 29.70% | 10.78% | 0.00% | NA |
| Indica I | 595 | 70.30% | 17.80% | 11.93% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.00% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 2.20% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121697590 | C -> A | LOC_Os11g36740-LOC_Os11g36760 | intergenic_region ; MODIFIER | silent_mutation | Average:10.969; most accessible tissue: Zhenshan97 flag leaf, score: 20.297 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121697590 | NA | 7.31E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121697590 | NA | 3.44E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121697590 | NA | 2.55E-06 | mr1479_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121697590 | NA | 4.68E-07 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121697590 | NA | 3.02E-06 | mr1742_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |