\
| Variant ID: vg1121673447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21673447 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 72. )
TCAAGTAGCTAGTACGCACGGCTTGCTGGAGCGAGGTCCTCAGTTCGATCCCCTACCAGCGCACAAGCTAATCCTCACCCTAGTTTACATTTTCATAGGC[A/G]
AACATTTGGCTCCGAGAGACATTTTGAAACTGGGGATGAGTTGCGGCCTTTTCCGATCTGTCTATAATCCGTGCTACCTTGGCCCTGTTTGGTTCCATGG
CCATGGAACCAAACAGGGCCAAGGTAGCACGGATTATAGACAGATCGGAAAAGGCCGCAACTCATCCCCAGTTTCAAAATGTCTCTCGGAGCCAAATGTT[T/C]
GCCTATGAAAATGTAAACTAGGGTGAGGATTAGCTTGTGCGCTGGTAGGGGATCGAACTGAGGACCTCGCTCCAGCAAGCCGTGCGTACTAGCTACTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 13.90% | 0.97% | 35.46% | NA |
| All Indica | 2759 | 39.30% | 14.60% | 1.41% | 44.69% | NA |
| All Japonica | 1512 | 70.60% | 10.60% | 0.33% | 18.39% | NA |
| Aus | 269 | 55.00% | 24.20% | 0.00% | 20.82% | NA |
| Indica I | 595 | 21.80% | 47.40% | 1.01% | 29.75% | NA |
| Indica II | 465 | 42.80% | 3.00% | 1.94% | 52.26% | NA |
| Indica III | 913 | 44.20% | 4.40% | 1.42% | 49.95% | NA |
| Indica Intermediate | 786 | 44.70% | 8.50% | 1.40% | 45.42% | NA |
| Temperate Japonica | 767 | 82.70% | 7.80% | 0.39% | 9.13% | NA |
| Tropical Japonica | 504 | 54.80% | 16.50% | 0.40% | 28.37% | NA |
| Japonica Intermediate | 241 | 65.60% | 7.50% | 0.00% | 26.97% | NA |
| VI/Aromatic | 96 | 6.20% | 6.20% | 1.04% | 86.46% | NA |
| Intermediate | 90 | 47.80% | 22.20% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121673447 | A -> DEL | N | N | silent_mutation | Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg1121673447 | A -> G | LOC_Os11g36719.1 | upstream_gene_variant ; 1580.0bp to feature; MODIFIER | silent_mutation | Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg1121673447 | A -> G | LOC_Os11g36700.1 | downstream_gene_variant ; 475.0bp to feature; MODIFIER | silent_mutation | Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg1121673447 | A -> G | LOC_Os11g36700-LOC_Os11g36719 | intergenic_region ; MODIFIER | silent_mutation | Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121673447 | NA | 9.21E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 1.80E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 2.21E-06 | mr1031 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 4.09E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 1.38E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 3.94E-06 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 1.61E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 1.43E-06 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 5.86E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121673447 | NA | 1.93E-06 | mr1986 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |