\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121673447:

Variant ID: vg1121673447 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21673447
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAGTAGCTAGTACGCACGGCTTGCTGGAGCGAGGTCCTCAGTTCGATCCCCTACCAGCGCACAAGCTAATCCTCACCCTAGTTTACATTTTCATAGGC[A/G]
AACATTTGGCTCCGAGAGACATTTTGAAACTGGGGATGAGTTGCGGCCTTTTCCGATCTGTCTATAATCCGTGCTACCTTGGCCCTGTTTGGTTCCATGG

Reverse complement sequence

CCATGGAACCAAACAGGGCCAAGGTAGCACGGATTATAGACAGATCGGAAAAGGCCGCAACTCATCCCCAGTTTCAAAATGTCTCTCGGAGCCAAATGTT[T/C]
GCCTATGAAAATGTAAACTAGGGTGAGGATTAGCTTGTGCGCTGGTAGGGGATCGAACTGAGGACCTCGCTCCAGCAAGCCGTGCGTACTAGCTACTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 13.90% 0.97% 35.46% NA
All Indica  2759 39.30% 14.60% 1.41% 44.69% NA
All Japonica  1512 70.60% 10.60% 0.33% 18.39% NA
Aus  269 55.00% 24.20% 0.00% 20.82% NA
Indica I  595 21.80% 47.40% 1.01% 29.75% NA
Indica II  465 42.80% 3.00% 1.94% 52.26% NA
Indica III  913 44.20% 4.40% 1.42% 49.95% NA
Indica Intermediate  786 44.70% 8.50% 1.40% 45.42% NA
Temperate Japonica  767 82.70% 7.80% 0.39% 9.13% NA
Tropical Japonica  504 54.80% 16.50% 0.40% 28.37% NA
Japonica Intermediate  241 65.60% 7.50% 0.00% 26.97% NA
VI/Aromatic  96 6.20% 6.20% 1.04% 86.46% NA
Intermediate  90 47.80% 22.20% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121673447 A -> DEL N N silent_mutation Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1121673447 A -> G LOC_Os11g36719.1 upstream_gene_variant ; 1580.0bp to feature; MODIFIER silent_mutation Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1121673447 A -> G LOC_Os11g36700.1 downstream_gene_variant ; 475.0bp to feature; MODIFIER silent_mutation Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1121673447 A -> G LOC_Os11g36700-LOC_Os11g36719 intergenic_region ; MODIFIER silent_mutation Average:30.386; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121673447 NA 9.21E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 1.80E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 2.21E-06 mr1031 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 4.09E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 1.38E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 3.94E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 1.61E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 1.43E-06 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 5.86E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121673447 NA 1.93E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251