\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121670141:

Variant ID: vg1121670141 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21670141
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, G: 0.14, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCCCGAGATCCCGCCGAGGGAAGACCATGCTATTGGGCACCTCGTCATCTTGCCGCTTGCGATGCTGGTCAACGCTGCAATGCCTCATCATGGCCATG[C/G]
AAGCGCACCATAGCATCAGCCGCGCCGCTGCACCGTCGCTCCTACCCTTACCAGCATGTCTCATCCGTTTTTTTTACAAATTGGTCCTTTTCAAAAACTT

Reverse complement sequence

AAGTTTTTGAAAAGGACCAATTTGTAAAAAAAACGGATGAGACATGCTGGTAAGGGTAGGAGCGACGGTGCAGCGGCGCGGCTGATGCTATGGTGCGCTT[G/C]
CATGGCCATGATGAGGCATTGCAGCGTTGACCAGCATCGCAAGCGGCAAGATGACGAGGTGCCCAATAGCATGGTCTTCCCTCGGCGGGATCTCGGGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 13.90% 0.63% 35.82% NA
All Indica  2759 39.10% 14.60% 0.80% 45.42% NA
All Japonica  1512 70.80% 10.60% 0.40% 18.19% NA
Aus  269 55.00% 24.20% 0.37% 20.45% NA
Indica I  595 21.70% 47.60% 0.67% 30.08% NA
Indica II  465 42.80% 3.00% 1.51% 52.69% NA
Indica III  913 44.20% 4.40% 0.66% 50.71% NA
Indica Intermediate  786 44.30% 8.50% 0.64% 46.56% NA
Temperate Japonica  767 82.70% 7.80% 0.00% 9.52% NA
Tropical Japonica  504 55.20% 16.50% 0.99% 27.38% NA
Japonica Intermediate  241 65.60% 7.50% 0.41% 26.56% NA
VI/Aromatic  96 6.20% 6.20% 0.00% 87.50% NA
Intermediate  90 47.80% 22.20% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121670141 C -> DEL N N silent_mutation Average:34.32; most accessible tissue: Callus, score: 80.315 N N N N
vg1121670141 C -> G LOC_Os11g36700.1 upstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:34.32; most accessible tissue: Callus, score: 80.315 N N N N
vg1121670141 C -> G LOC_Os11g36719.1 upstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:34.32; most accessible tissue: Callus, score: 80.315 N N N N
vg1121670141 C -> G LOC_Os11g36690.1 downstream_gene_variant ; 2975.0bp to feature; MODIFIER silent_mutation Average:34.32; most accessible tissue: Callus, score: 80.315 N N N N
vg1121670141 C -> G LOC_Os11g36690-LOC_Os11g36700 intergenic_region ; MODIFIER silent_mutation Average:34.32; most accessible tissue: Callus, score: 80.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121670141 NA 4.97E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 NA 8.36E-07 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 3.46E-06 NA mr1504 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 NA 9.50E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 NA 5.74E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 NA 1.87E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 1.33E-06 3.10E-09 mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 3.96E-06 7.97E-07 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 NA 8.08E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141 NA 3.96E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251