Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121670141:

Variant ID: vg1121670141 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21670141
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, G: 0.14, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

TGCCCCGAGATCCCGCCGAGGGAAGACCATGCTATTGGGCACCTCGTCATCTTGCCGCTTGCGATGCTGGTCAACGCTGCAATGCCTCATCATGGCCATG[C/G]
AAGCGCACCATAGCATCAGCCGCGCCGCTGCACCGTCGCTCCTACCCTTACCAGCATGTCTCATCCGTTTTTTTTACAAATTGGTCCTTTTCAAAAACTT

Reverse complement sequence

AAGTTTTTGAAAAGGACCAATTTGTAAAAAAAACGGATGAGACATGCTGGTAAGGGTAGGAGCGACGGTGCAGCGGCGCGGCTGATGCTATGGTGCGCTT[G/C]
CATGGCCATGATGAGGCATTGCAGCGTTGACCAGCATCGCAAGCGGCAAGATGACGAGGTGCCCAATAGCATGGTCTTCCCTCGGCGGGATCTCGGGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	13.90%	0.63%	35.82%	NA
All Indica	2759	39.10%	14.60%	0.80%	45.42%	NA
All Japonica	1512	70.80%	10.60%	0.40%	18.19%	NA
Aus	269	55.00%	24.20%	0.37%	20.45%	NA
Indica I	595	21.70%	47.60%	0.67%	30.08%	NA
Indica II	465	42.80%	3.00%	1.51%	52.69%	NA
Indica III	913	44.20%	4.40%	0.66%	50.71%	NA
Indica Intermediate	786	44.30%	8.50%	0.64%	46.56%	NA
Temperate Japonica	767	82.70%	7.80%	0.00%	9.52%	NA
Tropical Japonica	504	55.20%	16.50%	0.99%	27.38%	NA
Japonica Intermediate	241	65.60%	7.50%	0.41%	26.56%	NA
VI/Aromatic	96	6.20%	6.20%	0.00%	87.50%	NA
Intermediate	90	47.80%	22.20%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121670141	C -> DEL	N	N	silent_mutation	Average:34.32; most accessible tissue: Callus, score: 80.315	N	N	N	N
vg1121670141	C -> G	LOC_Os11g36700.1	upstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:34.32; most accessible tissue: Callus, score: 80.315	N	N	N	N
vg1121670141	C -> G	LOC_Os11g36719.1	upstream_gene_variant ; 4886.0bp to feature; MODIFIER	silent_mutation	Average:34.32; most accessible tissue: Callus, score: 80.315	N	N	N	N
vg1121670141	C -> G	LOC_Os11g36690.1	downstream_gene_variant ; 2975.0bp to feature; MODIFIER	silent_mutation	Average:34.32; most accessible tissue: Callus, score: 80.315	N	N	N	N
vg1121670141	C -> G	LOC_Os11g36690-LOC_Os11g36700	intergenic_region ; MODIFIER	silent_mutation	Average:34.32; most accessible tissue: Callus, score: 80.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121670141	NA	4.97E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	NA	8.36E-07	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	3.46E-06	NA	mr1504	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	NA	9.50E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	NA	5.74E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	NA	1.87E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	1.33E-06	3.10E-09	mr1986	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	3.96E-06	7.97E-07	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	NA	8.08E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121670141	NA	3.96E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251