\
| Variant ID: vg1121670141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21670141 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, G: 0.14, others allele: 0.00, population size: 70. )
TGCCCCGAGATCCCGCCGAGGGAAGACCATGCTATTGGGCACCTCGTCATCTTGCCGCTTGCGATGCTGGTCAACGCTGCAATGCCTCATCATGGCCATG[C/G]
AAGCGCACCATAGCATCAGCCGCGCCGCTGCACCGTCGCTCCTACCCTTACCAGCATGTCTCATCCGTTTTTTTTACAAATTGGTCCTTTTCAAAAACTT
AAGTTTTTGAAAAGGACCAATTTGTAAAAAAAACGGATGAGACATGCTGGTAAGGGTAGGAGCGACGGTGCAGCGGCGCGGCTGATGCTATGGTGCGCTT[G/C]
CATGGCCATGATGAGGCATTGCAGCGTTGACCAGCATCGCAAGCGGCAAGATGACGAGGTGCCCAATAGCATGGTCTTCCCTCGGCGGGATCTCGGGGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 13.90% | 0.63% | 35.82% | NA |
| All Indica | 2759 | 39.10% | 14.60% | 0.80% | 45.42% | NA |
| All Japonica | 1512 | 70.80% | 10.60% | 0.40% | 18.19% | NA |
| Aus | 269 | 55.00% | 24.20% | 0.37% | 20.45% | NA |
| Indica I | 595 | 21.70% | 47.60% | 0.67% | 30.08% | NA |
| Indica II | 465 | 42.80% | 3.00% | 1.51% | 52.69% | NA |
| Indica III | 913 | 44.20% | 4.40% | 0.66% | 50.71% | NA |
| Indica Intermediate | 786 | 44.30% | 8.50% | 0.64% | 46.56% | NA |
| Temperate Japonica | 767 | 82.70% | 7.80% | 0.00% | 9.52% | NA |
| Tropical Japonica | 504 | 55.20% | 16.50% | 0.99% | 27.38% | NA |
| Japonica Intermediate | 241 | 65.60% | 7.50% | 0.41% | 26.56% | NA |
| VI/Aromatic | 96 | 6.20% | 6.20% | 0.00% | 87.50% | NA |
| Intermediate | 90 | 47.80% | 22.20% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121670141 | C -> DEL | N | N | silent_mutation | Average:34.32; most accessible tissue: Callus, score: 80.315 | N | N | N | N |
| vg1121670141 | C -> G | LOC_Os11g36700.1 | upstream_gene_variant ; 2223.0bp to feature; MODIFIER | silent_mutation | Average:34.32; most accessible tissue: Callus, score: 80.315 | N | N | N | N |
| vg1121670141 | C -> G | LOC_Os11g36719.1 | upstream_gene_variant ; 4886.0bp to feature; MODIFIER | silent_mutation | Average:34.32; most accessible tissue: Callus, score: 80.315 | N | N | N | N |
| vg1121670141 | C -> G | LOC_Os11g36690.1 | downstream_gene_variant ; 2975.0bp to feature; MODIFIER | silent_mutation | Average:34.32; most accessible tissue: Callus, score: 80.315 | N | N | N | N |
| vg1121670141 | C -> G | LOC_Os11g36690-LOC_Os11g36700 | intergenic_region ; MODIFIER | silent_mutation | Average:34.32; most accessible tissue: Callus, score: 80.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121670141 | NA | 4.97E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | NA | 8.36E-07 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | 3.46E-06 | NA | mr1504 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | NA | 9.50E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | NA | 5.74E-07 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | NA | 1.87E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | 1.33E-06 | 3.10E-09 | mr1986 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | 3.96E-06 | 7.97E-07 | mr1986 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | NA | 8.08E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121670141 | NA | 3.96E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |