| Variant ID: vg1121646803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21646803 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATAGTACAAAATAAATTTATTTCGTTGCTAAACAGCATAATCTTCTATGTTACTATGTACTTTGTATAGTTTGCATCTTTAGTTAATCATCCAAAAAA[A/G]
CTATAAACACAATTAAGATGATGTGCTTTGAAAATTTAGATCAAATATAGATTCAACATCAAAAGCAAAAACTAAGGTGATATGGCTTTGTAAGAGAAGA
TCTTCTCTTACAAAGCCATATCACCTTAGTTTTTGCTTTTGATGTTGAATCTATATTTGATCTAAATTTTCAAAGCACATCATCTTAATTGTGTTTATAG[T/C]
TTTTTTGGATGATTAACTAAAGATGCAAACTATACAAAGTACATAGTAACATAGAAGATTATGCTGTTTAGCAACGAAATAAATTTATTTTGTACTATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 19.40% | 0.91% | 27.74% | NA |
| All Indica | 2759 | 65.20% | 4.10% | 1.23% | 29.50% | NA |
| All Japonica | 1512 | 30.00% | 51.70% | 0.26% | 18.12% | NA |
| Aus | 269 | 53.20% | 2.20% | 0.37% | 44.24% | NA |
| Indica I | 595 | 66.40% | 8.60% | 1.34% | 23.70% | NA |
| Indica II | 465 | 70.30% | 3.70% | 1.51% | 24.52% | NA |
| Indica III | 913 | 63.40% | 0.80% | 0.55% | 35.27% | NA |
| Indica Intermediate | 786 | 63.20% | 4.80% | 1.78% | 30.15% | NA |
| Temperate Japonica | 767 | 12.30% | 76.80% | 0.13% | 10.82% | NA |
| Tropical Japonica | 504 | 59.30% | 12.70% | 0.40% | 27.58% | NA |
| Japonica Intermediate | 241 | 24.90% | 53.10% | 0.41% | 21.58% | NA |
| VI/Aromatic | 96 | 15.60% | 0.00% | 1.04% | 83.33% | NA |
| Intermediate | 90 | 50.00% | 20.00% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121646803 | A -> DEL | N | N | silent_mutation | Average:15.758; most accessible tissue: Callus, score: 33.765 | N | N | N | N |
| vg1121646803 | A -> G | LOC_Os11g36670.1 | downstream_gene_variant ; 2200.0bp to feature; MODIFIER | silent_mutation | Average:15.758; most accessible tissue: Callus, score: 33.765 | N | N | N | N |
| vg1121646803 | A -> G | LOC_Os11g36660-LOC_Os11g36670 | intergenic_region ; MODIFIER | silent_mutation | Average:15.758; most accessible tissue: Callus, score: 33.765 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121646803 | NA | 8.00E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121646803 | 9.94E-07 | 9.94E-07 | mr1666_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121646803 | 7.13E-06 | 4.15E-06 | mr1761_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121646803 | 8.19E-06 | NA | mr1815_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121646803 | NA | 8.58E-12 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |