\
| Variant ID: vg1121625049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21625049 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGTATTGGGGTACGTTGGTACAAGGATCTACGTAGTACGACATCAAGCAAACAAAAGACGAGAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCC[C/A]
TAATCCAGTTGATGTGGGGTTATATGGTGGAAAACACAGGTTACAAAGAGAACAATGGAACTTGTCGAATCCGGCGAGATCGTAGTCGAGTTGGTTCGAC
GTCGAACCAACTCGACTACGATCTCGCCGGATTCGACAAGTTCCATTGTTCTCTTTGTAACCTGTGTTTTCCACCATATAACCCCACATCAACTGGATTA[G/T]
GGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTCTCGTCTTTTGTTTGCTTGATGTCGTACTACGTAGATCCTTGTACCAACGTACCCCAATACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 12.70% | 2.01% | 1.27% | NA |
| All Indica | 2759 | 80.00% | 17.00% | 2.90% | 0.04% | NA |
| All Japonica | 1512 | 95.80% | 0.20% | 0.33% | 3.70% | NA |
| Aus | 269 | 77.30% | 19.70% | 2.23% | 0.74% | NA |
| Indica I | 595 | 94.80% | 4.00% | 1.01% | 0.17% | NA |
| Indica II | 465 | 93.30% | 4.50% | 2.15% | 0.00% | NA |
| Indica III | 913 | 60.10% | 35.70% | 4.16% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 12.60% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 0.00% | 0.52% | 4.82% | NA |
| Tropical Japonica | 504 | 98.60% | 0.20% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.80% | 0.41% | 5.39% | NA |
| VI/Aromatic | 96 | 30.20% | 66.70% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121625049 | C -> A | LOC_Os11g36640.1 | upstream_gene_variant ; 180.0bp to feature; MODIFIER | silent_mutation | Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg1121625049 | C -> A | LOC_Os11g36650.1 | downstream_gene_variant ; 4648.0bp to feature; MODIFIER | silent_mutation | Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg1121625049 | C -> A | LOC_Os11g36640-LOC_Os11g36650 | intergenic_region ; MODIFIER | silent_mutation | Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg1121625049 | C -> DEL | N | N | silent_mutation | Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121625049 | 7.64E-06 | NA | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 5.53E-06 | NA | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 2.05E-06 | 5.49E-06 | mr1257 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 7.42E-06 | NA | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 2.84E-06 | NA | mr1251_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | NA | 4.03E-06 | mr1253_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 4.66E-08 | NA | mr1255_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 6.40E-07 | 1.25E-06 | mr1255_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 6.55E-06 | NA | mr1257_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121625049 | 3.15E-06 | NA | mr1435_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |