Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121625049:

Variant ID: vg1121625049 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21625049
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGTATTGGGGTACGTTGGTACAAGGATCTACGTAGTACGACATCAAGCAAACAAAAGACGAGAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCC[C/A]
TAATCCAGTTGATGTGGGGTTATATGGTGGAAAACACAGGTTACAAAGAGAACAATGGAACTTGTCGAATCCGGCGAGATCGTAGTCGAGTTGGTTCGAC

Reverse complement sequence

GTCGAACCAACTCGACTACGATCTCGCCGGATTCGACAAGTTCCATTGTTCTCTTTGTAACCTGTGTTTTCCACCATATAACCCCACATCAACTGGATTA[G/T]
GGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTCTCGTCTTTTGTTTGCTTGATGTCGTACTACGTAGATCCTTGTACCAACGTACCCCAATACCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	12.70%	2.01%	1.27%	NA
All Indica	2759	80.00%	17.00%	2.90%	0.04%	NA
All Japonica	1512	95.80%	0.20%	0.33%	3.70%	NA
Aus	269	77.30%	19.70%	2.23%	0.74%	NA
Indica I	595	94.80%	4.00%	1.01%	0.17%	NA
Indica II	465	93.30%	4.50%	2.15%	0.00%	NA
Indica III	913	60.10%	35.70%	4.16%	0.00%	NA
Indica Intermediate	786	84.10%	12.60%	3.31%	0.00%	NA
Temperate Japonica	767	94.70%	0.00%	0.52%	4.82%	NA
Tropical Japonica	504	98.60%	0.20%	0.00%	1.19%	NA
Japonica Intermediate	241	93.40%	0.80%	0.41%	5.39%	NA
VI/Aromatic	96	30.20%	66.70%	3.12%	0.00%	NA
Intermediate	90	87.80%	10.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121625049	C -> A	LOC_Os11g36640.1	upstream_gene_variant ; 180.0bp to feature; MODIFIER	silent_mutation	Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg1121625049	C -> A	LOC_Os11g36650.1	downstream_gene_variant ; 4648.0bp to feature; MODIFIER	silent_mutation	Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg1121625049	C -> A	LOC_Os11g36640-LOC_Os11g36650	intergenic_region ; MODIFIER	silent_mutation	Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg1121625049	C -> DEL	N	N	silent_mutation	Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121625049	7.64E-06	NA	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	5.53E-06	NA	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	2.05E-06	5.49E-06	mr1257	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	7.42E-06	NA	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	2.84E-06	NA	mr1251_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	NA	4.03E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	4.66E-08	NA	mr1255_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	6.40E-07	1.25E-06	mr1255_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	6.55E-06	NA	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049	3.15E-06	NA	mr1435_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251