\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121625049:

Variant ID: vg1121625049 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21625049
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGTATTGGGGTACGTTGGTACAAGGATCTACGTAGTACGACATCAAGCAAACAAAAGACGAGAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCC[C/A]
TAATCCAGTTGATGTGGGGTTATATGGTGGAAAACACAGGTTACAAAGAGAACAATGGAACTTGTCGAATCCGGCGAGATCGTAGTCGAGTTGGTTCGAC

Reverse complement sequence

GTCGAACCAACTCGACTACGATCTCGCCGGATTCGACAAGTTCCATTGTTCTCTTTGTAACCTGTGTTTTCCACCATATAACCCCACATCAACTGGATTA[G/T]
GGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTCTCGTCTTTTGTTTGCTTGATGTCGTACTACGTAGATCCTTGTACCAACGTACCCCAATACCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 12.70% 2.01% 1.27% NA
All Indica  2759 80.00% 17.00% 2.90% 0.04% NA
All Japonica  1512 95.80% 0.20% 0.33% 3.70% NA
Aus  269 77.30% 19.70% 2.23% 0.74% NA
Indica I  595 94.80% 4.00% 1.01% 0.17% NA
Indica II  465 93.30% 4.50% 2.15% 0.00% NA
Indica III  913 60.10% 35.70% 4.16% 0.00% NA
Indica Intermediate  786 84.10% 12.60% 3.31% 0.00% NA
Temperate Japonica  767 94.70% 0.00% 0.52% 4.82% NA
Tropical Japonica  504 98.60% 0.20% 0.00% 1.19% NA
Japonica Intermediate  241 93.40% 0.80% 0.41% 5.39% NA
VI/Aromatic  96 30.20% 66.70% 3.12% 0.00% NA
Intermediate  90 87.80% 10.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121625049 C -> A LOC_Os11g36640.1 upstream_gene_variant ; 180.0bp to feature; MODIFIER silent_mutation Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1121625049 C -> A LOC_Os11g36650.1 downstream_gene_variant ; 4648.0bp to feature; MODIFIER silent_mutation Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1121625049 C -> A LOC_Os11g36640-LOC_Os11g36650 intergenic_region ; MODIFIER silent_mutation Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1121625049 C -> DEL N N silent_mutation Average:13.911; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121625049 7.64E-06 NA mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 5.53E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 2.05E-06 5.49E-06 mr1257 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 7.42E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 2.84E-06 NA mr1251_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 NA 4.03E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 4.66E-08 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 6.40E-07 1.25E-06 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 6.55E-06 NA mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121625049 3.15E-06 NA mr1435_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251