\
| Variant ID: vg1121617585 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21617585 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 43. )
TGCAGCTTGACTTAGTGGTTATCACATTAAGAAGATCTCGAGGGTGCCCTTGCTGGCCAAGATCATCGTATCCAATACTGGAAGATGAAGTTTGAAGTGG[C/T]
GGAACTCGAGAGAACCATGCTGGCAGTGAAGAAAGAGCAGGCTGTGGAAACGCTCCAAGGTCGCGAGGTGTGGTTTAACTCGTACTTGAAGAGTTGCTGC
GCAGCAACTCTTCAAGTACGAGTTAAACCACACCTCGCGACCTTGGAGCGTTTCCACAGCCTGCTCTTTCTTCACTGCCAGCATGGTTCTCTCGAGTTCC[G/A]
CCACTTCAAACTTCATCTTCCAGTATTGGATACGATGATCTTGGCCAGCAAGGGCACCCTCGAGATCTTCTTAATGTGATAACCACTAAGTCAAGCTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 21.30% | 6.58% | 9.29% | NA |
| All Indica | 2759 | 55.50% | 33.50% | 7.61% | 3.44% | NA |
| All Japonica | 1512 | 73.60% | 3.20% | 3.90% | 19.31% | NA |
| Aus | 269 | 85.50% | 1.90% | 10.41% | 2.23% | NA |
| Indica I | 595 | 66.10% | 12.80% | 14.79% | 6.39% | NA |
| Indica II | 465 | 37.00% | 54.40% | 6.24% | 2.37% | NA |
| Indica III | 913 | 57.90% | 35.80% | 4.27% | 1.97% | NA |
| Indica Intermediate | 786 | 55.50% | 34.10% | 6.87% | 3.56% | NA |
| Temperate Japonica | 767 | 83.20% | 1.30% | 3.52% | 11.99% | NA |
| Tropical Japonica | 504 | 61.10% | 6.30% | 5.75% | 26.79% | NA |
| Japonica Intermediate | 241 | 69.30% | 2.50% | 1.24% | 26.97% | NA |
| VI/Aromatic | 96 | 45.80% | 16.70% | 7.29% | 30.21% | NA |
| Intermediate | 90 | 60.00% | 13.30% | 7.78% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121617585 | C -> T | LOC_Os11g36630.1 | missense_variant ; p.Ala578Val; MODERATE | nonsynonymous_codon ; A578V | Average:12.773; most accessible tissue: Minghui63 root, score: 25.504 | benign |
0.448 |
TOLERATED | 0.06 |
| vg1121617585 | C -> DEL | LOC_Os11g36630.1 | N | frameshift_variant | Average:12.773; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121617585 | 3.94E-06 | 5.79E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 1.71E-06 | 4.54E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 4.37E-06 | NA | mr1128 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 1.08E-06 | 1.51E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 9.13E-06 | NA | mr1139 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 8.07E-06 | 9.87E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 5.90E-06 | 3.94E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | NA | 6.39E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | NA | 6.70E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | NA | 4.75E-10 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | NA | 2.82E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | NA | 9.49E-06 | mr1772 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | 7.01E-06 | NA | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121617585 | NA | 3.35E-06 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |