\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121561284:

Variant ID: vg1121561284 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21561284
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGTAGATTAATCATTTAAAGGGTAAAAACAATTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTAAACCATAGATTAATCATTT[A/G]
AGCACTAACTAAGTGAGGATGAACTATATAAGTATACAGGATATCATAAAACATAATAAAGATATACATTAAAACATTATGTGAATTATGTTGGATGATA

Reverse complement sequence

TATCATCCAACATAATTCACATAATGTTTTAATGTATATCTTTATTATGTTTTATGATATCCTGTATACTTATATAGTTCATCCTCACTTAGTTAGTGCT[T/C]
AAATGATTAATCTATGGTTTAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAATTGTTTTTACCCTTTAAATGATTAATCTACTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 30.30% 0.25% 36.80% NA
All Indica  2759 46.10% 6.70% 0.25% 46.86% NA
All Japonica  1512 4.20% 77.50% 0.33% 17.99% NA
Aus  269 66.90% 11.50% 0.00% 21.56% NA
Indica I  595 61.70% 6.60% 0.17% 31.60% NA
Indica II  465 41.10% 3.70% 0.22% 55.05% NA
Indica III  913 42.10% 5.70% 0.11% 52.14% NA
Indica Intermediate  786 42.10% 9.90% 0.51% 47.46% NA
Temperate Japonica  767 5.90% 84.90% 0.39% 8.87% NA
Tropical Japonica  504 1.20% 70.40% 0.00% 28.37% NA
Japonica Intermediate  241 5.00% 68.90% 0.83% 25.31% NA
VI/Aromatic  96 3.10% 7.30% 0.00% 89.58% NA
Intermediate  90 25.60% 41.10% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121561284 A -> DEL N N silent_mutation Average:15.31; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561284 A -> G LOC_Os11g36530.1 upstream_gene_variant ; 4857.0bp to feature; MODIFIER silent_mutation Average:15.31; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561284 A -> G LOC_Os11g36550.1 upstream_gene_variant ; 556.0bp to feature; MODIFIER silent_mutation Average:15.31; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561284 A -> G LOC_Os11g36530-LOC_Os11g36550 intergenic_region ; MODIFIER silent_mutation Average:15.31; most accessible tissue: Callus, score: 36.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121561284 1.74E-07 1.74E-07 mr1438_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284 NA 1.23E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284 1.39E-06 1.39E-06 mr1908_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284 8.44E-08 2.62E-09 mr1994_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284 NA 5.86E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251