Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121561284:

Variant ID: vg1121561284 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21561284
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTAGATTAATCATTTAAAGGGTAAAAACAATTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTAAACCATAGATTAATCATTT[A/G]
AGCACTAACTAAGTGAGGATGAACTATATAAGTATACAGGATATCATAAAACATAATAAAGATATACATTAAAACATTATGTGAATTATGTTGGATGATA

Reverse complement sequence

TATCATCCAACATAATTCACATAATGTTTTAATGTATATCTTTATTATGTTTTATGATATCCTGTATACTTATATAGTTCATCCTCACTTAGTTAGTGCT[T/C]
AAATGATTAATCTATGGTTTAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAATTGTTTTTACCCTTTAAATGATTAATCTACTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	30.30%	0.25%	36.80%	NA
All Indica	2759	46.10%	6.70%	0.25%	46.86%	NA
All Japonica	1512	4.20%	77.50%	0.33%	17.99%	NA
Aus	269	66.90%	11.50%	0.00%	21.56%	NA
Indica I	595	61.70%	6.60%	0.17%	31.60%	NA
Indica II	465	41.10%	3.70%	0.22%	55.05%	NA
Indica III	913	42.10%	5.70%	0.11%	52.14%	NA
Indica Intermediate	786	42.10%	9.90%	0.51%	47.46%	NA
Temperate Japonica	767	5.90%	84.90%	0.39%	8.87%	NA
Tropical Japonica	504	1.20%	70.40%	0.00%	28.37%	NA
Japonica Intermediate	241	5.00%	68.90%	0.83%	25.31%	NA
VI/Aromatic	96	3.10%	7.30%	0.00%	89.58%	NA
Intermediate	90	25.60%	41.10%	0.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121561284	A -> DEL	N	N	silent_mutation	Average:15.31; most accessible tissue: Callus, score: 36.581	N	N	N	N
vg1121561284	A -> G	LOC_Os11g36530.1	upstream_gene_variant ; 4857.0bp to feature; MODIFIER	silent_mutation	Average:15.31; most accessible tissue: Callus, score: 36.581	N	N	N	N
vg1121561284	A -> G	LOC_Os11g36550.1	upstream_gene_variant ; 556.0bp to feature; MODIFIER	silent_mutation	Average:15.31; most accessible tissue: Callus, score: 36.581	N	N	N	N
vg1121561284	A -> G	LOC_Os11g36530-LOC_Os11g36550	intergenic_region ; MODIFIER	silent_mutation	Average:15.31; most accessible tissue: Callus, score: 36.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121561284	1.74E-07	1.74E-07	mr1438_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284	NA	1.23E-06	mr1561_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284	1.39E-06	1.39E-06	mr1908_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284	8.44E-08	2.62E-09	mr1994_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561284	NA	5.86E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251