\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121561200:

Variant ID: vg1121561200 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21561200
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAGTATGTAGAATGGTGATTGAAATGTAAAAAGTAAGGTGGTATGACTTTATGGAAGAAGAAAAGTAGAGAGATAGTTTGGACAGTAGATTAATCAT[T/C]
TAAAGGGTAAAAACAATTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTAAACCATAGATTAATCATTTAAGCACTAACTAAGTGA

Reverse complement sequence

TCACTTAGTTAGTGCTTAAATGATTAATCTATGGTTTAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAATTGTTTTTACCCTTTA[A/G]
ATGATTAATCTACTGTCCAAACTATCTCTCTACTTTTCTTCTTCCATAAAGTCATACCACCTTACTTTTTACATTTCAATCACCATTCTACATACTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 24.70% 0.17% 36.99% NA
All Indica  2759 50.30% 2.50% 0.22% 46.90% NA
All Japonica  1512 12.20% 69.00% 0.13% 18.58% NA
Aus  269 67.70% 10.80% 0.00% 21.56% NA
Indica I  595 66.90% 1.30% 0.17% 31.60% NA
Indica II  465 41.90% 2.40% 0.43% 55.27% NA
Indica III  913 46.70% 1.10% 0.00% 52.25% NA
Indica Intermediate  786 47.10% 5.20% 0.38% 47.33% NA
Temperate Japonica  767 11.50% 79.10% 0.13% 9.26% NA
Tropical Japonica  504 15.70% 55.20% 0.00% 29.17% NA
Japonica Intermediate  241 7.50% 66.00% 0.41% 26.14% NA
VI/Aromatic  96 8.30% 3.10% 0.00% 88.54% NA
Intermediate  90 41.10% 25.60% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121561200 T -> DEL N N silent_mutation Average:14.982; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561200 T -> C LOC_Os11g36530.1 upstream_gene_variant ; 4773.0bp to feature; MODIFIER silent_mutation Average:14.982; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561200 T -> C LOC_Os11g36550.1 upstream_gene_variant ; 640.0bp to feature; MODIFIER silent_mutation Average:14.982; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561200 T -> C LOC_Os11g36530-LOC_Os11g36550 intergenic_region ; MODIFIER silent_mutation Average:14.982; most accessible tissue: Callus, score: 36.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121561200 4.76E-06 2.05E-06 mr1148 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561200 2.87E-06 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561200 5.06E-06 5.06E-06 mr1651 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561200 NA 8.14E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251