\
| Variant ID: vg1121561182 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21561182 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.04, others allele: 0.00, population size: 82. )
TTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTGAAATGTAAAAAGTAAGGTGGTATGACTTTATGGAAGAAGAAAAGTAGAGAGATAGTTT[G/A]
GACAGTAGATTAATCATTTAAAGGGTAAAAACAATTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTAAACCATAGATTAATCATT
AATGATTAATCTATGGTTTAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAATTGTTTTTACCCTTTAAATGATTAATCTACTGTC[C/T]
AAACTATCTCTCTACTTTTCTTCTTCCATAAAGTCATACCACCTTACTTTTTACATTTCAATCACCATTCTACATACTATTTAAATTTAAATTATCATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 30.30% | 0.28% | 36.84% | NA |
| All Indica | 2759 | 46.10% | 6.80% | 0.29% | 46.86% | NA |
| All Japonica | 1512 | 4.10% | 77.40% | 0.26% | 18.19% | NA |
| Aus | 269 | 66.90% | 11.20% | 0.37% | 21.56% | NA |
| Indica I | 595 | 61.70% | 6.60% | 0.34% | 31.43% | NA |
| Indica II | 465 | 40.60% | 3.70% | 0.43% | 55.27% | NA |
| Indica III | 913 | 42.10% | 5.80% | 0.00% | 52.14% | NA |
| Indica Intermediate | 786 | 42.10% | 9.90% | 0.51% | 47.46% | NA |
| Temperate Japonica | 767 | 5.70% | 85.00% | 0.00% | 9.26% | NA |
| Tropical Japonica | 504 | 1.20% | 69.80% | 0.79% | 28.17% | NA |
| Japonica Intermediate | 241 | 5.00% | 69.30% | 0.00% | 25.73% | NA |
| VI/Aromatic | 96 | 3.10% | 8.30% | 0.00% | 88.54% | NA |
| Intermediate | 90 | 25.60% | 41.10% | 0.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121561182 | G -> A | LOC_Os11g36530.1 | upstream_gene_variant ; 4755.0bp to feature; MODIFIER | silent_mutation | Average:17.036; most accessible tissue: Callus, score: 36.581 | N | N | N | N |
| vg1121561182 | G -> A | LOC_Os11g36550.1 | upstream_gene_variant ; 658.0bp to feature; MODIFIER | silent_mutation | Average:17.036; most accessible tissue: Callus, score: 36.581 | N | N | N | N |
| vg1121561182 | G -> A | LOC_Os11g36530-LOC_Os11g36550 | intergenic_region ; MODIFIER | silent_mutation | Average:17.036; most accessible tissue: Callus, score: 36.581 | N | N | N | N |
| vg1121561182 | G -> DEL | N | N | silent_mutation | Average:17.036; most accessible tissue: Callus, score: 36.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121561182 | 8.81E-07 | 8.81E-07 | mr1438_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121561182 | NA | 2.89E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121561182 | NA | 3.72E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121561182 | 1.16E-06 | 1.16E-06 | mr1908_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121561182 | 1.93E-08 | 7.34E-10 | mr1994_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |