\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121561182:

Variant ID: vg1121561182 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21561182
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.04, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGATAATTTAAATTTAAATAGTATGTAGAATGGTGATTGAAATGTAAAAAGTAAGGTGGTATGACTTTATGGAAGAAGAAAAGTAGAGAGATAGTTT[G/A]
GACAGTAGATTAATCATTTAAAGGGTAAAAACAATTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTTAAACCATAGATTAATCATT

Reverse complement sequence

AATGATTAATCTATGGTTTAAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAATTGTTTTTACCCTTTAAATGATTAATCTACTGTC[C/T]
AAACTATCTCTCTACTTTTCTTCTTCCATAAAGTCATACCACCTTACTTTTTACATTTCAATCACCATTCTACATACTATTTAAATTTAAATTATCATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.60% 30.30% 0.28% 36.84% NA
All Indica  2759 46.10% 6.80% 0.29% 46.86% NA
All Japonica  1512 4.10% 77.40% 0.26% 18.19% NA
Aus  269 66.90% 11.20% 0.37% 21.56% NA
Indica I  595 61.70% 6.60% 0.34% 31.43% NA
Indica II  465 40.60% 3.70% 0.43% 55.27% NA
Indica III  913 42.10% 5.80% 0.00% 52.14% NA
Indica Intermediate  786 42.10% 9.90% 0.51% 47.46% NA
Temperate Japonica  767 5.70% 85.00% 0.00% 9.26% NA
Tropical Japonica  504 1.20% 69.80% 0.79% 28.17% NA
Japonica Intermediate  241 5.00% 69.30% 0.00% 25.73% NA
VI/Aromatic  96 3.10% 8.30% 0.00% 88.54% NA
Intermediate  90 25.60% 41.10% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121561182 G -> A LOC_Os11g36530.1 upstream_gene_variant ; 4755.0bp to feature; MODIFIER silent_mutation Average:17.036; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561182 G -> A LOC_Os11g36550.1 upstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:17.036; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561182 G -> A LOC_Os11g36530-LOC_Os11g36550 intergenic_region ; MODIFIER silent_mutation Average:17.036; most accessible tissue: Callus, score: 36.581 N N N N
vg1121561182 G -> DEL N N silent_mutation Average:17.036; most accessible tissue: Callus, score: 36.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121561182 8.81E-07 8.81E-07 mr1438_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561182 NA 2.89E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561182 NA 3.72E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561182 1.16E-06 1.16E-06 mr1908_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121561182 1.93E-08 7.34E-10 mr1994_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251