Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121559924:

Variant ID: vg1121559924 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21559924
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGTTCGTTTTTGGAAATGCAGAAGGAGTCGTATAAGAAATTTAAATAAAAAATTCGCATATTAACTTGAGATGATCGGACTCCTACTTACAGCTCATG[G/T]
TTTTTTTAGAAAAATATATATCCAAGCGAATTCTCAAGTGAATTTCACCTTAATTAAACCATATAACGATAATAAGATAACCTTCACCCGTTGCAACACA

Reverse complement sequence

TGTGTTGCAACGGGTGAAGGTTATCTTATTATCGTTATATGGTTTAATTAAGGTGAAATTCACTTGAGAATTCGCTTGGATATATATTTTTCTAAAAAAA[C/A]
CATGAGCTGTAAGTAGGAGTCCGATCATCTCAAGTTAATATGCGAATTTTTTATTTAAATTTCTTATACGACTCCTTCTGCATTTCCAAAAACGAACGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	30.30%	0.19%	36.92%	NA
All Indica	2759	46.00%	6.80%	0.22%	46.94%	NA
All Japonica	1512	4.10%	77.40%	0.13%	18.32%	NA
Aus	269	67.30%	11.20%	0.00%	21.56%	NA
Indica I	595	61.50%	6.90%	0.67%	30.92%	NA
Indica II	465	40.90%	3.70%	0.22%	55.27%	NA
Indica III	913	42.10%	5.50%	0.11%	52.35%	NA
Indica Intermediate	786	42.00%	10.20%	0.00%	47.84%	NA
Temperate Japonica	767	5.70%	85.10%	0.13%	9.00%	NA
Tropical Japonica	504	1.20%	69.80%	0.20%	28.77%	NA
Japonica Intermediate	241	5.00%	68.90%	0.00%	26.14%	NA
VI/Aromatic	96	3.10%	7.30%	1.04%	88.54%	NA
Intermediate	90	25.60%	41.10%	0.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121559924	G -> T	LOC_Os11g36530.1	upstream_gene_variant ; 3497.0bp to feature; MODIFIER	silent_mutation	Average:15.097; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N
vg1121559924	G -> T	LOC_Os11g36550.1	upstream_gene_variant ; 1916.0bp to feature; MODIFIER	silent_mutation	Average:15.097; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N
vg1121559924	G -> T	LOC_Os11g36530-LOC_Os11g36550	intergenic_region ; MODIFIER	silent_mutation	Average:15.097; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N
vg1121559924	G -> DEL	N	N	silent_mutation	Average:15.097; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121559924	NA	9.00E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	9.55E-06	3.13E-07	mr1330_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	NA	5.34E-07	mr1380_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	2.42E-07	7.92E-09	mr1561_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	NA	5.09E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	6.33E-07	2.47E-07	mr1875_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	5.17E-10	5.17E-10	mr1908_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	NA	3.33E-06	mr1994_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121559924	NA	2.53E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251