\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121442556:

Variant ID: vg1121442556 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21442556
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTACTCTTTACAACAAAAGGTTAACATTGTTCTTAAATTTGCTACTTGCACGAGCATTACGTTTGAAGTCTAAACCACATTTTTTCTTATCTTACATC[G/C]
AAAACTCATTTCAGCATCCAATTAACTCCAAATACAAATACAGCCGTTCAAATTAACATTTCAATTCAATGATTTTGCCCATATATAGTATATCCAAACT

Reverse complement sequence

AGTTTGGATATACTATATATGGGCAAAATCATTGAATTGAAATGTTAATTTGAACGGCTGTATTTGTATTTGGAGTTAATTGGATGCTGAAATGAGTTTT[C/G]
GATGTAAGATAAGAAAAAATGTGGTTTAGACTTCAAACGTAATGCTCGTGCAAGTAGCAAATTTAAGAACAATGTTAACCTTTTGTTGTAAAGAGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 4.70% 0.28% 5.04% NA
All Indica  2759 95.00% 4.00% 0.07% 0.87% NA
All Japonica  1512 79.20% 6.10% 0.60% 14.09% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 94.60% 4.90% 0.00% 0.50% NA
Indica II  465 97.40% 0.00% 0.00% 2.58% NA
Indica III  913 94.50% 5.10% 0.22% 0.11% NA
Indica Intermediate  786 94.50% 4.50% 0.00% 1.02% NA
Temperate Japonica  767 91.40% 1.70% 0.13% 6.78% NA
Tropical Japonica  504 62.10% 14.70% 0.99% 22.22% NA
Japonica Intermediate  241 76.30% 2.10% 1.24% 20.33% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121442556 G -> DEL N N silent_mutation Average:42.594; most accessible tissue: Callus, score: 85.563 N N N N
vg1121442556 G -> C LOC_Os11g36380.1 upstream_gene_variant ; 2515.0bp to feature; MODIFIER silent_mutation Average:42.594; most accessible tissue: Callus, score: 85.563 N N N N
vg1121442556 G -> C LOC_Os11g36390.1 upstream_gene_variant ; 496.0bp to feature; MODIFIER silent_mutation Average:42.594; most accessible tissue: Callus, score: 85.563 N N N N
vg1121442556 G -> C LOC_Os11g36380-LOC_Os11g36390 intergenic_region ; MODIFIER silent_mutation Average:42.594; most accessible tissue: Callus, score: 85.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121442556 NA 5.56E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121442556 1.54E-06 1.54E-06 mr1151 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121442556 1.78E-07 1.78E-07 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251