\
| Variant ID: vg1121442556 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21442556 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.00, others allele: 0.00, population size: 241. )
TTTTACTCTTTACAACAAAAGGTTAACATTGTTCTTAAATTTGCTACTTGCACGAGCATTACGTTTGAAGTCTAAACCACATTTTTTCTTATCTTACATC[G/C]
AAAACTCATTTCAGCATCCAATTAACTCCAAATACAAATACAGCCGTTCAAATTAACATTTCAATTCAATGATTTTGCCCATATATAGTATATCCAAACT
AGTTTGGATATACTATATATGGGCAAAATCATTGAATTGAAATGTTAATTTGAACGGCTGTATTTGTATTTGGAGTTAATTGGATGCTGAAATGAGTTTT[C/G]
GATGTAAGATAAGAAAAAATGTGGTTTAGACTTCAAACGTAATGCTCGTGCAAGTAGCAAATTTAAGAACAATGTTAACCTTTTGTTGTAAAGAGTAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 4.70% | 0.28% | 5.04% | NA |
| All Indica | 2759 | 95.00% | 4.00% | 0.07% | 0.87% | NA |
| All Japonica | 1512 | 79.20% | 6.10% | 0.60% | 14.09% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 94.60% | 4.90% | 0.00% | 0.50% | NA |
| Indica II | 465 | 97.40% | 0.00% | 0.00% | 2.58% | NA |
| Indica III | 913 | 94.50% | 5.10% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 94.50% | 4.50% | 0.00% | 1.02% | NA |
| Temperate Japonica | 767 | 91.40% | 1.70% | 0.13% | 6.78% | NA |
| Tropical Japonica | 504 | 62.10% | 14.70% | 0.99% | 22.22% | NA |
| Japonica Intermediate | 241 | 76.30% | 2.10% | 1.24% | 20.33% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121442556 | G -> DEL | N | N | silent_mutation | Average:42.594; most accessible tissue: Callus, score: 85.563 | N | N | N | N |
| vg1121442556 | G -> C | LOC_Os11g36380.1 | upstream_gene_variant ; 2515.0bp to feature; MODIFIER | silent_mutation | Average:42.594; most accessible tissue: Callus, score: 85.563 | N | N | N | N |
| vg1121442556 | G -> C | LOC_Os11g36390.1 | upstream_gene_variant ; 496.0bp to feature; MODIFIER | silent_mutation | Average:42.594; most accessible tissue: Callus, score: 85.563 | N | N | N | N |
| vg1121442556 | G -> C | LOC_Os11g36380-LOC_Os11g36390 | intergenic_region ; MODIFIER | silent_mutation | Average:42.594; most accessible tissue: Callus, score: 85.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121442556 | NA | 5.56E-07 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121442556 | 1.54E-06 | 1.54E-06 | mr1151 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121442556 | 1.78E-07 | 1.78E-07 | mr1249 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |