Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121442556:

Variant ID: vg1121442556 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21442556
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTACTCTTTACAACAAAAGGTTAACATTGTTCTTAAATTTGCTACTTGCACGAGCATTACGTTTGAAGTCTAAACCACATTTTTTCTTATCTTACATC[G/C]
AAAACTCATTTCAGCATCCAATTAACTCCAAATACAAATACAGCCGTTCAAATTAACATTTCAATTCAATGATTTTGCCCATATATAGTATATCCAAACT

Reverse complement sequence

AGTTTGGATATACTATATATGGGCAAAATCATTGAATTGAAATGTTAATTTGAACGGCTGTATTTGTATTTGGAGTTAATTGGATGCTGAAATGAGTTTT[C/G]
GATGTAAGATAAGAAAAAATGTGGTTTAGACTTCAAACGTAATGCTCGTGCAAGTAGCAAATTTAAGAACAATGTTAACCTTTTGTTGTAAAGAGTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	4.70%	0.28%	5.04%	NA
All Indica	2759	95.00%	4.00%	0.07%	0.87%	NA
All Japonica	1512	79.20%	6.10%	0.60%	14.09%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	94.60%	4.90%	0.00%	0.50%	NA
Indica II	465	97.40%	0.00%	0.00%	2.58%	NA
Indica III	913	94.50%	5.10%	0.22%	0.11%	NA
Indica Intermediate	786	94.50%	4.50%	0.00%	1.02%	NA
Temperate Japonica	767	91.40%	1.70%	0.13%	6.78%	NA
Tropical Japonica	504	62.10%	14.70%	0.99%	22.22%	NA
Japonica Intermediate	241	76.30%	2.10%	1.24%	20.33%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121442556	G -> DEL	N	N	silent_mutation	Average:42.594; most accessible tissue: Callus, score: 85.563	N	N	N	N
vg1121442556	G -> C	LOC_Os11g36380.1	upstream_gene_variant ; 2515.0bp to feature; MODIFIER	silent_mutation	Average:42.594; most accessible tissue: Callus, score: 85.563	N	N	N	N
vg1121442556	G -> C	LOC_Os11g36390.1	upstream_gene_variant ; 496.0bp to feature; MODIFIER	silent_mutation	Average:42.594; most accessible tissue: Callus, score: 85.563	N	N	N	N
vg1121442556	G -> C	LOC_Os11g36380-LOC_Os11g36390	intergenic_region ; MODIFIER	silent_mutation	Average:42.594; most accessible tissue: Callus, score: 85.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121442556	NA	5.56E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121442556	1.54E-06	1.54E-06	mr1151	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121442556	1.78E-07	1.78E-07	mr1249	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251