\
| Variant ID: vg1121410783 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 21410783 |
| Reference Allele: ATG | Alternative Allele: GTG,A |
| Primary Allele: GTG | Secondary Allele: ATG |
Inferred Ancestral Allele: Not determined.
GACCGAGAAAATGAACTAAAATGATACTCCCTCCTTACCTAAATGGACACCGTTGATTTTTTTAAACATATTTGACCGTTTGTCTTATTCAAAAACTTTT[ATG/GTG,A]
AAATATGTAAAACTATATGTATAGATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTAAAATAAGACGAA
TTCGTCTTATTTTAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATCTATACATATAGTTTTACATATTT[CAT/CAC,T]
AAAAGTTTTTGAATAAGACAAACGGTCAAATATGTTTAAAAAAATCAACGGTGTCCATTTAGGTAAGGAGGGAGTATCATTTTAGTTCATTTTCTCGGTC
| Populations | Population Size | Frequency of GTG(primary allele) | Frequency of ATG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 32.60% | 2.98% | 5.67% | A: 0.06% |
| All Indica | 2759 | 80.10% | 5.80% | 4.78% | 9.24% | A: 0.07% |
| All Japonica | 1512 | 15.70% | 83.10% | 0.40% | 0.73% | A: 0.07% |
| Aus | 269 | 89.60% | 9.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 67.90% | 18.30% | 7.06% | 6.72% | NA |
| Indica II | 465 | 72.50% | 1.10% | 9.46% | 16.99% | NA |
| Indica III | 913 | 92.10% | 1.00% | 0.66% | 6.24% | NA |
| Indica Intermediate | 786 | 80.00% | 4.60% | 5.09% | 10.05% | A: 0.25% |
| Temperate Japonica | 767 | 12.00% | 86.60% | 0.26% | 1.04% | A: 0.13% |
| Tropical Japonica | 504 | 21.60% | 77.40% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 14.90% | 84.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121410783 | ATG -> GTG | LOC_Os11g36340.1 | upstream_gene_variant ; 2813.0bp to feature; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1121410783 | ATG -> GTG | LOC_Os11g36330.1 | downstream_gene_variant ; 4411.0bp to feature; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1121410783 | ATG -> GTG | LOC_Os11g36330-LOC_Os11g36340 | intergenic_region ; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1121410783 | ATG -> A | LOC_Os11g36340.1 | upstream_gene_variant ; 2812.0bp to feature; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1121410783 | ATG -> A | LOC_Os11g36330.1 | downstream_gene_variant ; 4412.0bp to feature; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1121410783 | ATG -> A | LOC_Os11g36330-LOC_Os11g36340 | intergenic_region ; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg1121410783 | ATG -> DEL | N | N | silent_mutation | Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121410783 | NA | 2.81E-07 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121410783 | 3.19E-07 | 5.37E-09 | mr1561_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121410783 | NA | 1.78E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121410783 | 7.18E-06 | 2.50E-08 | mr1875_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121410783 | 2.90E-09 | 2.90E-09 | mr1908_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121410783 | NA | 3.83E-07 | mr1994_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121410783 | NA | 2.15E-07 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |