\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121410783:

Variant ID: vg1121410783 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 21410783
Reference Allele: ATGAlternative Allele: GTG,A
Primary Allele: GTGSecondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACCGAGAAAATGAACTAAAATGATACTCCCTCCTTACCTAAATGGACACCGTTGATTTTTTTAAACATATTTGACCGTTTGTCTTATTCAAAAACTTTT[ATG/GTG,A]
AAATATGTAAAACTATATGTATAGATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTAAAATAAGACGAA

Reverse complement sequence

TTCGTCTTATTTTAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATCTATACATATAGTTTTACATATTT[CAT/CAC,T]
AAAAGTTTTTGAATAAGACAAACGGTCAAATATGTTTAAAAAAATCAACGGTGTCCATTTAGGTAAGGAGGGAGTATCATTTTAGTTCATTTTCTCGGTC

Allele Frequencies:

Populations Population SizeFrequency of GTG(primary allele) Frequency of ATG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 32.60% 2.98% 5.67% A: 0.06%
All Indica  2759 80.10% 5.80% 4.78% 9.24% A: 0.07%
All Japonica  1512 15.70% 83.10% 0.40% 0.73% A: 0.07%
Aus  269 89.60% 9.70% 0.74% 0.00% NA
Indica I  595 67.90% 18.30% 7.06% 6.72% NA
Indica II  465 72.50% 1.10% 9.46% 16.99% NA
Indica III  913 92.10% 1.00% 0.66% 6.24% NA
Indica Intermediate  786 80.00% 4.60% 5.09% 10.05% A: 0.25%
Temperate Japonica  767 12.00% 86.60% 0.26% 1.04% A: 0.13%
Tropical Japonica  504 21.60% 77.40% 0.40% 0.60% NA
Japonica Intermediate  241 14.90% 84.20% 0.83% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121410783 ATG -> GTG LOC_Os11g36340.1 upstream_gene_variant ; 2813.0bp to feature; MODIFIER silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1121410783 ATG -> GTG LOC_Os11g36330.1 downstream_gene_variant ; 4411.0bp to feature; MODIFIER silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1121410783 ATG -> GTG LOC_Os11g36330-LOC_Os11g36340 intergenic_region ; MODIFIER silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1121410783 ATG -> A LOC_Os11g36340.1 upstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1121410783 ATG -> A LOC_Os11g36330.1 downstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1121410783 ATG -> A LOC_Os11g36330-LOC_Os11g36340 intergenic_region ; MODIFIER silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg1121410783 ATG -> DEL N N silent_mutation Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121410783 NA 2.81E-07 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783 3.19E-07 5.37E-09 mr1561_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783 NA 1.78E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783 7.18E-06 2.50E-08 mr1875_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783 2.90E-09 2.90E-09 mr1908_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783 NA 3.83E-07 mr1994_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783 NA 2.15E-07 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251