Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121410783:

Variant ID: vg1121410783 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 21410783
Reference Allele: ATG	Alternative Allele: GTG,A
Primary Allele: GTG	Secondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACCGAGAAAATGAACTAAAATGATACTCCCTCCTTACCTAAATGGACACCGTTGATTTTTTTAAACATATTTGACCGTTTGTCTTATTCAAAAACTTTT[ATG/GTG,A]
AAATATGTAAAACTATATGTATAGATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTAAAATAAGACGAA

Reverse complement sequence

TTCGTCTTATTTTAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATCTATACATATAGTTTTACATATTT[CAT/CAC,T]
AAAAGTTTTTGAATAAGACAAACGGTCAAATATGTTTAAAAAAATCAACGGTGTCCATTTAGGTAAGGAGGGAGTATCATTTTAGTTCATTTTCTCGGTC

Allele Frequencies:

Populations	Population Size	Frequency of GTG(primary allele)	Frequency of ATG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	32.60%	2.98%	5.67%	A: 0.06%
All Indica	2759	80.10%	5.80%	4.78%	9.24%	A: 0.07%
All Japonica	1512	15.70%	83.10%	0.40%	0.73%	A: 0.07%
Aus	269	89.60%	9.70%	0.74%	0.00%	NA
Indica I	595	67.90%	18.30%	7.06%	6.72%	NA
Indica II	465	72.50%	1.10%	9.46%	16.99%	NA
Indica III	913	92.10%	1.00%	0.66%	6.24%	NA
Indica Intermediate	786	80.00%	4.60%	5.09%	10.05%	A: 0.25%
Temperate Japonica	767	12.00%	86.60%	0.26%	1.04%	A: 0.13%
Tropical Japonica	504	21.60%	77.40%	0.40%	0.60%	NA
Japonica Intermediate	241	14.90%	84.20%	0.83%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	41.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121410783	ATG -> GTG	LOC_Os11g36340.1	upstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1121410783	ATG -> GTG	LOC_Os11g36330.1	downstream_gene_variant ; 4411.0bp to feature; MODIFIER	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1121410783	ATG -> GTG	LOC_Os11g36330-LOC_Os11g36340	intergenic_region ; MODIFIER	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1121410783	ATG -> A	LOC_Os11g36340.1	upstream_gene_variant ; 2812.0bp to feature; MODIFIER	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1121410783	ATG -> A	LOC_Os11g36330.1	downstream_gene_variant ; 4412.0bp to feature; MODIFIER	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1121410783	ATG -> A	LOC_Os11g36330-LOC_Os11g36340	intergenic_region ; MODIFIER	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg1121410783	ATG -> DEL	N	N	silent_mutation	Average:51.12; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121410783	NA	2.81E-07	mr1380_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783	3.19E-07	5.37E-09	mr1561_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783	NA	1.78E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783	7.18E-06	2.50E-08	mr1875_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783	2.90E-09	2.90E-09	mr1908_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783	NA	3.83E-07	mr1994_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121410783	NA	2.15E-07	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251