\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121399841:

Variant ID: vg1121399841 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21399841
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAGTGTTGTAAAGAACACATGCACATTTAAGCGTGCGCTTAAAAAGGGATTGTTTCGAGAGAGTCAAGCAAGAGCACTAACAGGATTTTCACCGCCCG[A/G]
AAGGGAAAAATCCGTCTCCTCCTTTCAATTGGTATCTCACTATTTTATATTAGGCTGTGGTTGCTATAACAAGTTCCCATCCGGAACGGTGATCACGGAA

Reverse complement sequence

TTCCGTGATCACCGTTCCGGATGGGAACTTGTTATAGCAACCACAGCCTAATATAAAATAGTGAGATACCAATTGAAAGGAGGAGACGGATTTTTCCCTT[T/C]
CGGGCGGTGAAAATCCTGTTAGTGCTCTTGCTTGACTCTCTCGAAACAATCCCTTTTTAAGCGCACGCTTAAATGTGCATGTGTTCTTTACAACACTTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 23.60% 1.08% 0.42% NA
All Indica  2759 59.30% 38.30% 1.70% 0.72% NA
All Japonica  1512 96.70% 3.10% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.10% 31.10% 0.50% 0.34% NA
Indica II  465 41.90% 53.30% 4.30% 0.43% NA
Indica III  913 63.90% 34.10% 1.10% 0.99% NA
Indica Intermediate  786 57.60% 39.70% 1.78% 0.89% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 3.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121399841 A -> DEL N N silent_mutation Average:32.459; most accessible tissue: Zhenshan97 flower, score: 83.915 N N N N
vg1121399841 A -> G LOC_Os11g36320-LOC_Os11g36330 intergenic_region ; MODIFIER silent_mutation Average:32.459; most accessible tissue: Zhenshan97 flower, score: 83.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121399841 A G -0.01 -0.01 0.0 0.0 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121399841 8.96E-07 3.53E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121399841 1.41E-06 2.05E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121399841 3.77E-06 NA mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121399841 3.22E-06 NA mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121399841 7.25E-07 5.77E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121399841 1.58E-06 1.54E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251