\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121397261:

Variant ID: vg1121397261 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21397261
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCTAGTGACGAATGAGTGTTGTTTTCTTACGCAGTGCTTTTTTAAGGGATATTCTCACAACTTAAACAAAACAACATATACTAGCCACATAGTCGCGC[G/A]
ATGCGCGACTGTTAATTCTATTTAAGAACTTTTGTATATGCCTTATTAGTTTACCTTAACTTTTAAGAAGGTTTTGATATAAGTTAATTTGTTTACGAAG

Reverse complement sequence

CTTCGTAAACAAATTAACTTATATCAAAACCTTCTTAAAAGTTAAGGTAAACTAATAAGGCATATACAAAAGTTCTTAAATAGAATTAACAGTCGCGCAT[C/T]
GCGCGACTATGTGGCTAGTATATGTTGTTTTGTTTAAGTTGTGAGAATATCCCTTAAAAAAGCACTGCGTAAGAAAACAACACTCATTCGTCACTAGCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 24.50% 0.36% 24.12% NA
All Indica  2759 53.90% 7.80% 0.54% 37.80% NA
All Japonica  1512 43.70% 53.20% 0.00% 3.11% NA
Aus  269 65.80% 26.40% 0.37% 7.43% NA
Indica I  595 46.40% 22.50% 0.34% 30.76% NA
Indica II  465 42.80% 3.00% 1.51% 52.69% NA
Indica III  913 64.20% 1.30% 0.22% 34.28% NA
Indica Intermediate  786 54.10% 7.00% 0.51% 38.42% NA
Temperate Japonica  767 30.80% 66.40% 0.00% 2.87% NA
Tropical Japonica  504 52.80% 43.50% 0.00% 3.77% NA
Japonica Intermediate  241 66.00% 31.50% 0.00% 2.49% NA
VI/Aromatic  96 35.40% 42.70% 1.04% 20.83% NA
Intermediate  90 57.80% 31.10% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121397261 G -> A LOC_Os11g36320-LOC_Os11g36330 intergenic_region ; MODIFIER silent_mutation Average:52.807; most accessible tissue: Zhenshan97 root, score: 91.119 N N N N
vg1121397261 G -> DEL N N silent_mutation Average:52.807; most accessible tissue: Zhenshan97 root, score: 91.119 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121397261 G A -0.01 -0.02 -0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121397261 1.09E-06 NA mr1243 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251