\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121385012:

Variant ID: vg1121385012 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21385012
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACCTATTTATATAATAGTTACGAATAAAAATATACTAATCTATTAATACCCGGTCACACCTCTCATATACACACAACGTCTTCAAGTCTGTATTGCC[A/G]
CTGGCAACAAATCTACAGTTCGTTTTTTTCTCTCTTCTTTAATATTCTTGATATGTGGTTCTAGCTTGCTCTAACATGCATATTTTCCTTGCACAAAAAT

Reverse complement sequence

ATTTTTGTGCAAGGAAAATATGCATGTTAGAGCAAGCTAGAACCACATATCAAGAATATTAAAGAAGAGAGAAAAAAACGAACTGTAGATTTGTTGCCAG[T/C]
GGCAATACAGACTTGAAGACGTTGTGTGTATATGAGAGGTGTGACCGGGTATTAATAGATTAGTATATTTTTATTCGTAACTATTATATAAATAGGTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 40.60% 1.46% 0.06% NA
All Indica  2759 85.10% 14.60% 0.33% 0.00% NA
All Japonica  1512 14.60% 84.50% 0.66% 0.20% NA
Aus  269 42.00% 39.80% 18.22% 0.00% NA
Indica I  595 78.70% 21.20% 0.17% 0.00% NA
Indica II  465 94.00% 4.90% 1.08% 0.00% NA
Indica III  913 83.70% 16.20% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.40% 0.25% 0.00% NA
Temperate Japonica  767 11.20% 87.10% 1.30% 0.39% NA
Tropical Japonica  504 20.00% 80.00% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121385012 A -> DEL N N silent_mutation Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1121385012 A -> G LOC_Os11g36310.1 upstream_gene_variant ; 1216.0bp to feature; MODIFIER silent_mutation Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1121385012 A -> G LOC_Os11g36320.1 downstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1121385012 A -> G LOC_Os11g36310-LOC_Os11g36320 intergenic_region ; MODIFIER silent_mutation Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121385012 7.26E-06 6.71E-08 mr1380_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 4.16E-07 1.21E-08 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 5.89E-06 3.48E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 NA 4.39E-06 mr1698_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 7.08E-06 2.76E-08 mr1875_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 4.50E-09 4.50E-09 mr1908_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 NA 4.06E-06 mr1994_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012 4.04E-06 5.74E-08 mr1996_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251