Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121385012:

Variant ID: vg1121385012 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21385012
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

ATAACCTATTTATATAATAGTTACGAATAAAAATATACTAATCTATTAATACCCGGTCACACCTCTCATATACACACAACGTCTTCAAGTCTGTATTGCC[A/G]
CTGGCAACAAATCTACAGTTCGTTTTTTTCTCTCTTCTTTAATATTCTTGATATGTGGTTCTAGCTTGCTCTAACATGCATATTTTCCTTGCACAAAAAT

Reverse complement sequence

ATTTTTGTGCAAGGAAAATATGCATGTTAGAGCAAGCTAGAACCACATATCAAGAATATTAAAGAAGAGAGAAAAAAACGAACTGTAGATTTGTTGCCAG[T/C]
GGCAATACAGACTTGAAGACGTTGTGTGTATATGAGAGGTGTGACCGGGTATTAATAGATTAGTATATTTTTATTCGTAACTATTATATAAATAGGTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	40.60%	1.46%	0.06%	NA
All Indica	2759	85.10%	14.60%	0.33%	0.00%	NA
All Japonica	1512	14.60%	84.50%	0.66%	0.20%	NA
Aus	269	42.00%	39.80%	18.22%	0.00%	NA
Indica I	595	78.70%	21.20%	0.17%	0.00%	NA
Indica II	465	94.00%	4.90%	1.08%	0.00%	NA
Indica III	913	83.70%	16.20%	0.11%	0.00%	NA
Indica Intermediate	786	86.40%	13.40%	0.25%	0.00%	NA
Temperate Japonica	767	11.20%	87.10%	1.30%	0.39%	NA
Tropical Japonica	504	20.00%	80.00%	0.00%	0.00%	NA
Japonica Intermediate	241	14.10%	85.90%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121385012	A -> DEL	N	N	silent_mutation	Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1121385012	A -> G	LOC_Os11g36310.1	upstream_gene_variant ; 1216.0bp to feature; MODIFIER	silent_mutation	Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1121385012	A -> G	LOC_Os11g36320.1	downstream_gene_variant ; 337.0bp to feature; MODIFIER	silent_mutation	Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1121385012	A -> G	LOC_Os11g36310-LOC_Os11g36320	intergenic_region ; MODIFIER	silent_mutation	Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121385012	7.26E-06	6.71E-08	mr1380_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	4.16E-07	1.21E-08	mr1561_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	5.89E-06	3.48E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	NA	4.39E-06	mr1698_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	7.08E-06	2.76E-08	mr1875_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	4.50E-09	4.50E-09	mr1908_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	NA	4.06E-06	mr1994_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121385012	4.04E-06	5.74E-08	mr1996_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251