\
| Variant ID: vg1121385012 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21385012 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 186. )
ATAACCTATTTATATAATAGTTACGAATAAAAATATACTAATCTATTAATACCCGGTCACACCTCTCATATACACACAACGTCTTCAAGTCTGTATTGCC[A/G]
CTGGCAACAAATCTACAGTTCGTTTTTTTCTCTCTTCTTTAATATTCTTGATATGTGGTTCTAGCTTGCTCTAACATGCATATTTTCCTTGCACAAAAAT
ATTTTTGTGCAAGGAAAATATGCATGTTAGAGCAAGCTAGAACCACATATCAAGAATATTAAAGAAGAGAGAAAAAAACGAACTGTAGATTTGTTGCCAG[T/C]
GGCAATACAGACTTGAAGACGTTGTGTGTATATGAGAGGTGTGACCGGGTATTAATAGATTAGTATATTTTTATTCGTAACTATTATATAAATAGGTTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.90% | 40.60% | 1.46% | 0.06% | NA |
| All Indica | 2759 | 85.10% | 14.60% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 14.60% | 84.50% | 0.66% | 0.20% | NA |
| Aus | 269 | 42.00% | 39.80% | 18.22% | 0.00% | NA |
| Indica I | 595 | 78.70% | 21.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.00% | 4.90% | 1.08% | 0.00% | NA |
| Indica III | 913 | 83.70% | 16.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 11.20% | 87.10% | 1.30% | 0.39% | NA |
| Tropical Japonica | 504 | 20.00% | 80.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 51.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121385012 | A -> DEL | N | N | silent_mutation | Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1121385012 | A -> G | LOC_Os11g36310.1 | upstream_gene_variant ; 1216.0bp to feature; MODIFIER | silent_mutation | Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1121385012 | A -> G | LOC_Os11g36320.1 | downstream_gene_variant ; 337.0bp to feature; MODIFIER | silent_mutation | Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1121385012 | A -> G | LOC_Os11g36310-LOC_Os11g36320 | intergenic_region ; MODIFIER | silent_mutation | Average:33.301; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121385012 | 7.26E-06 | 6.71E-08 | mr1380_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | 4.16E-07 | 1.21E-08 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | 5.89E-06 | 3.48E-21 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | NA | 4.39E-06 | mr1698_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | 7.08E-06 | 2.76E-08 | mr1875_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | 4.50E-09 | 4.50E-09 | mr1908_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | NA | 4.06E-06 | mr1994_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121385012 | 4.04E-06 | 5.74E-08 | mr1996_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |