\
| Variant ID: vg1121334009 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 21334009 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )
GGAGCCGGGCCCAAAACCGGCACCTATGAGGCCTTTATAACTGGCACCAATGAGTATTTTTGTGGTAGTGATAATATGGAGCGGGAAATTAACATTGCAC[C/T]
GGCGAAATAATACAGGTACAAATAATATGCATCCAAGACTGGTGCTCCCCATAATTATCGATCTTCTTCTCTCGCGATCGTTCAGTACTATTAAGACAGA
TCTGTCTTAATAGTACTGAACGATCGCGAGAGAAGAAGATCGATAATTATGGGGAGCACCAGTCTTGGATGCATATTATTTGTACCTGTATTATTTCGCC[G/A]
GTGCAATGTTAATTTCCCGCTCCATATTATCACTACCACAAAAATACTCATTGGTGCCAGTTATAAAGGCCTCATAGGTGCCGGTTTTGGGCCCGGCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 2.30% | 0.32% | 3.72% | NA |
| All Indica | 2759 | 97.70% | 0.10% | 0.07% | 2.14% | NA |
| All Japonica | 1512 | 91.90% | 6.70% | 0.13% | 1.26% | NA |
| Aus | 269 | 60.20% | 0.40% | 3.72% | 35.69% | NA |
| Indica I | 595 | 98.30% | 0.00% | 0.17% | 1.51% | NA |
| Indica II | 465 | 97.40% | 0.20% | 0.00% | 2.37% | NA |
| Indica III | 913 | 96.80% | 0.00% | 0.00% | 3.18% | NA |
| Indica Intermediate | 786 | 98.30% | 0.30% | 0.13% | 1.27% | NA |
| Temperate Japonica | 767 | 97.40% | 0.30% | 0.13% | 2.22% | NA |
| Tropical Japonica | 504 | 80.60% | 18.80% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1121334009 | C -> T | LOC_Os11g36240.1 | upstream_gene_variant ; 1325.0bp to feature; MODIFIER | silent_mutation | Average:57.435; most accessible tissue: Callus, score: 85.173 | N | N | N | N |
| vg1121334009 | C -> T | LOC_Os11g36230-LOC_Os11g36240 | intergenic_region ; MODIFIER | silent_mutation | Average:57.435; most accessible tissue: Callus, score: 85.173 | N | N | N | N |
| vg1121334009 | C -> DEL | N | N | silent_mutation | Average:57.435; most accessible tissue: Callus, score: 85.173 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1121334009 | 5.17E-07 | NA | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121334009 | NA | 3.25E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121334009 | 3.48E-07 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121334009 | 3.09E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121334009 | 3.82E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1121334009 | NA | 1.50E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |